Camelia, the Perl 6 bug

IRC log for #bioperl, 2009-05-25

| Channels | #bioperl index | Today | | Search | Google Search | Plain-Text | summary

All times shown according to UTC.

Time Nick Message
06:56 philsf joined #bioperl
07:54 faceface rbuels: deafferret: talking of talking, have you read http://producingoss.com/ - i.e. "sgn needs more expertise" lots of info in there about that.
07:55 faceface very relevant to Bio* projects
08:04 philsf joined #bioperl
09:48 faceface anyone alive?
09:48 faceface how do I check which xml parser SearchIO is using?
15:57 ericlee joined #bioperl
15:58 ericlee could Bio::Seq module reverse complements RNA sequence?
15:58 ericlee When I write that it shows following errors.
15:58 ericlee >vvi-miR828a
15:58 ericlee Bio::Seq=HASH(0x1ce09580)
15:58 ericlee >vvi-miR167a
15:58 ericlee Bio::Seq=HASH(0x1ce092a0)
15:58 ericlee >vvi-miR399a
15:58 ericlee Bio::Seq=HASH(0x1ce091e0)
15:58 ericlee >vvi-miR319b
15:58 ericlee Bio::Seq=HASH(0x1ce096e0)
15:59 ericlee So anyone could help me with that?
16:02 pyrimidine joined #bioperl
16:03 pyrimidine faceface: $searchio->saxparser();  # for blastxml
16:05 pyrimidine ericlee: revcom() returns a Bio::PrimarySeqI or Bio::SeqI
16:05 pyrimidine so you need something like $seq->revcom->seq to get the raw sequence
16:06 ericlee my $revcom_seq = $seqobj->revcom();
16:07 pyrimidine yes, that's likely a Bio::Seq object, not the raw sequence
16:07 ericlee but I wrote this one, still use;ess. :(
16:08 pyrimidine no, you need to write '$revcom_seq->seq' to get the actual sequence string
16:08 ericlee What's $seq->revcom->seq stand for?
16:09 pyrimidine 'get the revcomp for the Bio::Seq $seq, then get the sequence string'
16:09 ericlee my $revcom_seq = $seqobj->revcom->$raw_seq;
16:09 ericlee Like that?
16:09 pyrimidine $seq->revcom() gets a Bio::Seq; calling method seq() gets the sequence string itself
16:10 pyrimidine it evaluates left to right
16:10 pyrimidine yes
16:10 pyrimidine no, spoke too soon
16:10 pyrimidine $seqobj->revcom->seq
16:10 ericlee What? Could you say more clear?
16:11 ericlee seq? what it is? string, var?
16:11 pyrimidine how much perl do you know?
16:11 ericlee my $tag = $seqobj->primary_id();
16:11 ericlee my $raw_seq = $seqobj->seq();
16:11 ericlee my $revcom_seq = $seqobj->revcom->$raw_seq;
16:11 ericlee print ">$tag\n$revcom_seq\n";
16:12 pyrimidine no
16:12 pyrimidine (and, actually, that's not the bioperl way of doing it)
16:12 ericlee so how do I fix the script?
16:13 pyrimidine my $tag = $seqobj->primary_id();
16:13 pyrimidine my $revcom_seq = $seqobj->revcom->seq;
16:13 pyrimidine print ">$tag\n$revcom_seq\n";
16:14 ericlee Clear, thanks. seq is a method.
16:14 pyrimidine the bp-way is to create an output stream for fasta output via SeqIO
16:15 pyrimidine yes
16:15 pyrimidine attempting '$seqobj->revcom->$raw_seq;' would take the stringified version of $revcom_seq'
16:16 pyrimidine sorry, $revcom_seq, which would be a memory location for the object
16:16 pyrimidine and then attempt to use that as a method name
16:18 ericlee What's the revcom of CCGGAAGAGGAAAAUUAAGCAA
16:19 ericlee bp said it's TTGCTTUUTTTTCCTCTTCCGG
16:19 pyrimidine Well, technically it's RNA, so it shouldn't revcomp, but if anything it'll revcomp to DNA
16:19 pyrimidine yes
16:20 pyrimidine interesting with the U's
16:20 ericlee But U appears.
16:20 pyrimidine yes; that's a bug
16:21 pyrimidine But the question is, should RNA be capable of revcom()
16:21 pyrimidine ?
16:21 pyrimidine If revtranscribing to cDNA, yes
16:23 pyrimidine and (IIRC) there are RNA viruses that can replicate their RNA genome directly (slept since then, so not 100% confident on that)
16:25 pyrimidine ericlee: what version of bioperl are you using?
16:26 ericlee bioperl-live
16:26 ericlee not exact version'
16:26 pyrimidine that would be 1.006009
16:26 pyrimidine aka 'pre-1.7'
16:27 ericlee yep
16:27 ericlee are you a dev?
16:27 pyrimidine make sure $seqobj->alphabet() is 'rna'
16:27 pyrimidine yes
16:27 pyrimidine cjfields
16:27 ericlee Cool\
16:28 ericlee Bioperl is so great at oue research.
16:28 ericlee I wrote many for that.
16:29 pyrimidine good to hear
16:30 pyrimidine looking at the revcom() code, if the alphabet() is set to 'dna' it will likely get confused
16:30 ericlee It's true, our research is miRNA related.
16:30 pyrimidine and spit out the wrong string
16:31 ericlee so I should use  $seqobj->alphabet()?
16:31 pyrimidine it does account for RNA, though
16:32 ericlee interesting, that should fix that.
16:32 * pyrimidine back to $job
16:33 ericlee Thanks. you are patient and kind.
17:01 rbuels good morning all
17:02 rbuels pyrimidine: have i been enough of a pest yet  ;-)
17:08 rbuels faceface: that's a neat book.  was there a specific section that made you think of sgn, or just the whole thing?

| Channels | #bioperl index | Today | | Search | Google Search | Plain-Text | summary