Camelia, the Perl 6 bug

IRC log for #bioperl, 2009-07-06

| Channels | #bioperl index | Today | | Search | Google Search | Plain-Text | plain, newest first | summary

All times shown according to UTC.

Time S Nick Message
13:08 alper joined #bioperl
15:30 pyrimidine joined #bioperl
15:30 driley_ joined #bioperl
15:31 pyrimidine bioperl-bot: translate 'gattaca'
15:31 pyrimidine bioperl-bot--
15:32 deafferret tom cruise core dump
15:32 deafferret err ethan hawke
15:34 pyrimidine how do you call translate with bioperl-bot?
15:35 deafferret bioperl-bot translate ACTAATAGATCTTAAGATCTTTATATAGATCTTCT​TATTATTTTTACTATTAGGATCGCACTTTGCTGTG
15:35 bioperl-bot TNRS*DLYIDLLIIFTIRIALCC
15:35 deafferret <bioperl-bot> TNRS*DLYIDLLIIFTIRIALCC
15:35 deafferret http://bioperl.org/wiki/Bots
15:36 pyrimidine ok, no colon.  Just making sure.
15:53 pyrimidine bioperl-bot translate 'gataca'
15:53 pyrimidine bioperl-bot translate gataca
15:53 bioperl-bot DT
15:53 pyrimidine hah!
15:54 pyrimidine bioperl-bot's got the DT's
15:56 Dr_ST joined #bioperl
15:56 Dr_ST hi folks
15:56 Dr_ST anyone familiar with bioperl + hmm?
15:56 Dr_ST i have a little question conernning the profile retrieval
15:57 Dr_ST how do i get the number of 'gaps' in a sequence?
15:57 deafferret you might have to post some code samples of what you're attempting
15:57 deafferret http://sial.org/pbot/
15:58 pyrimidine I think, within the HSP, you use 'no_gaps' (which is one of my least favorite method names)
15:58 pyrimidine should be 'num_gaps'
15:59 * deafferret laughs nervously
15:59 pyrimidine could be worse, it could be 'numb_gaps'
15:59 Dr_ST hum, ok i'll try to post some code on the lin
15:59 Dr_ST k
16:00 deafferret gap_count
16:03 Dr_ST hum, i'm using this -> http://pastebin.mandriva.com/13544
16:04 Dr_ST (HMMER::Results)
16:04 Dr_ST i've not entered in the HSP really, but i "think" i may have my code evolving since this gap fetaure is a problem
16:05 Dr_ST moreover, i need the "total" number of gaps, but also if a gap is present in a subpart of the sequence ...
16:05 pyrimidine Dr_ST: Are you using HMMER2 or HMMER3?  the latter isn't supported yet.
16:07 pyrimidine Dr_ST: Oh, I see, you're using the older Bio::Tools::HMMER.  I suggest using Bio::SearchIO.
16:09 pyrimidine Dr_ST: http://www.bioperl.org/wiki/HO[…]#Table_of_Methods
16:09 pyrimidine Dr_ST: and the method to use is 'gaps'
16:11 Dr_ST pyrimidine: ha, everything is merged in the seach::IO method now? great
16:11 pyrimidine yes
16:11 Dr_ST my code was started some time ago, and at that time, i was also "beginning" with bioperl
16:12 pyrimidine Dr_ST: BLAST is the main one, but in general yes
16:12 Dr_ST that's great, i'll see if i can "rapidly merge this into the existing code, i do not want to break a working, limited but, working
16:12 Dr_ST ok
16:13 Dr_ST i've sometimes problem to see if the method is doing it automatically or not, so i try to find what has the relevant keyword first
16:13 Dr_ST + i need to use "older" bioperl because i'm not administering the public server :-(
16:13 Dr_ST thanks a lot, i'll see what i can do
16:13 pyrimidine You should look at Sendu's hmmer_pull module, which is very fast and has the same implementations
16:14 pyrimidine Oh, see here (about local bioperl):
16:14 pyrimidine http://www.bioperl.org/wiki/In[…]SONAL_MODULE_AREA
16:15 pyrimidine The SearchIO modules have only a few requirements (blastxml is the only XML-based SearchIO parser I think).  Should be easy to download it and point PERL5LIB to it (or add a 'use lib' directive)
16:16 Dr_ST i know this :-)
16:16 Dr_ST i'm maintaining the bioperl port for mandriva,
16:17 pyrimidine ok
16:17 Dr_ST the problem is not to install bioperl on my own directory, the problem is to use it, but that's technical, if i have a good reason to ask for it, then i'll kick the sysadmin :-)
16:17 Dr_ST hmm_pull is where ?
16:18 Dr_ST found it
16:18 Dr_ST i forgot the "er"
16:19 pyrimidine well, the last release was in January and is considered stable:
16:19 pyrimidine http://search.cpan.org/~cjfields/BioPerl-1.6.0/
16:20 pyrimidine I am cleaning up more bugs this month for a 1.6.x release (it may be 1.6.2, considering how bioperl-run is 1.6.1)
16:22 Dr_ST ok, thanks again for the pointers, i cannot follow anymore the bioperl mailing list for now (too much traffic to add to the other mailing lists), but congrats for the tremendous work you are doing!
16:23 pyrimidine thanks!
16:30 rbuels pyrimidine: feel free to toss a release-blocking bug or two my way
16:31 rbuels i will catch them out of the air and gobble them down like a trained seal.
16:31 rbuels that smells of fish.
16:31 pyrimidine eww
16:31 * deafferret sniffs
16:41 deafferret rbuels: I successfully failed to kill myself my first day on my 250cc dirt bike  :)   the extreme mudiness was partly resposible for my lower stupidity quotient
16:43 rbuels lol
16:44 rbuels when i was a teenager i knew a guy who successfully killed himself on a dirt bike.  he was 14 or 15 at the time, i think
16:45 rbuels his dad was not in good shape afterwards
16:45 rbuels so be careful!
16:45 deafferret not recommended
16:45 rbuels and make your kids be careful!
16:46 rbuels but that said, it sounds like fun.  ;-)
16:46 deafferret yup. always.   we showed up right as a kid was leaving muttering something about 3rd gear, a stump, over the handlebars, and how do I know if it's a concussion
16:47 deafferret that kid is about 80X more skilled + stupid than my son and I at this point  :)
16:52 perl_splut joined #bioperl
17:03 pyrimidine Anyone here work primarily with ActivePerl/Windows?  Want to get a PPM going?
17:03 pyrimidine http://bugzilla.open-bio.org/show_bug.cgi?id=2794
17:41 pyrimidine joined #bioperl
17:52 pyrimidine_ joined #bioperl
18:18 rowlesd joined #bioperl
18:38 deafferret rowlesd: you sound exactly like me 3 years ago  :)
18:39 deafferret I have a slew of "genetics for dummies" and books like that
18:39 deafferret how strong is your perl?
18:45 rowlesd It has been suggested to me that this would be a good place to direct a question, please excuse me if it isn't!
18:46 deafferret :)    this is the perfect place
18:46 rowlesd I am an experienced perl programmer who last studied biology 15 years ago, and who is hoping to learn something about BioPerl
18:47 pyrimidine_ ok
18:47 rowlesd My problem is that the documentation looks excellent for Biologists who want to learn about Perl, but I have been unable to locate any resources for programmers who want to learn about Biology
18:47 pyrimidine_ this place would work, though the mail list tends to get more response
18:48 rowlesd Can anyone suggest a place I might go to try and learn more?
18:49 pyrimidine_ An Introduction to Bioinformatics Algorithms (Computational Molecular Biology)
18:50 pyrimidine_ Jones and Pevzner
18:50 pyrimidine_ http://www.amazon.com/gp/product/0262101068
18:51 rowlesd Looks excellent - thank you very much
18:52 pyrimidine_ rowlesd: that's written from the computational science perspective but gives you background on common tasks in comp. biology
18:53 pyrimidine Another (classic) is Gusfield: Algorithms on Strings, Trees and Sequences: Computer Science and Computational Biology
18:53 pyrimidine http://www.amazon.com/Algorith[…]98/ref=pd_sim_b_1
18:56 rowlesd Thank you :)
19:03 rowlesd Thank you all very much for your help and suggested bedtime reading!
19:04 rbuels rowlesd: i would not recommend reading that stuff at bedtime, if you want to get through much of it  ;-)
19:04 rbuels or maybe that's just me
19:04 rbuels lol
19:04 rowlesd Yep - looks pretty heavy going
19:05 rbuels rowlesd: did you just get a position in a bio lab or something after working in 'normal' computer stuff?
19:06 rowlesd Not quite - I've got an interview for a post, and it looks really interesting, but I'd like to understand the area I'd be working in and what I'd be doing a lot better
19:09 rbuels hmm, textbooks might be overkill then
19:10 rbuels maybe some quick introduction material about molecular bio or something?
19:10 rbuels i would think that would be more enlightening than algorithms
19:10 rbuels for interviewing purposes
19:11 pyrimidine All depends
19:11 rbuels yeah depends on the job i guess
19:11 rbuels if rowlesd is getting hired out of industry though, he probably wouldn't be doing algorithms
19:12 pyrimidine if they're hiring you for your computational background, then knowledge of algorithms is a plus
19:12 pyrimidine actually, a few interviewers I know will ask if one knows how to write up a quick sort, just to gauge how much they know
19:13 pyrimidine (i.e. lie on a resume, you might get caught out)
19:13 rowlesd I've certainly done that myself when interviewing in the past!
19:13 rbuels ugh.  'write a quick sort' is not a good interview question if you want to find a good productive programmer.
19:14 rbuels code samples.
19:14 pyrimidine weeds out those who say they are adept from those who really are
19:14 rbuels have them code a solution to some kind of real-world-ish problem.
19:14 pyrimidine but then why hire them?
19:15 pyrimidine If you have the solution in hand, the problem is solved
19:15 pyrimidine no need for the job  ;)
19:15 * pyrimidine committed another FASTQ fix
19:16 rbuels there is no correlation between people who know a particular piece of programming trivia and people who will be productive programmers
19:17 rbuels you can find out how to write a quick sort in 15 seconds using google
19:17 rbuels you want people that know how to approach nontrivial problems, design solutions, etc
19:17 pyrimidine True, but if you state on your resume you have a computer science background be ready for questions along those lines
19:18 rbuels hah, my answer would be "that's not important"
19:18 rbuels and if they persist in asking questions like that i would seriously reconsider whether i wanted to work at such a clueless place
19:18 rbuels joel has a great guide about interviewing programmers:
19:18 rbuels http://www.joelonsoftware.com/[…]nterviewing3.html
19:19 pyrimidine I happen to agree with you BTW. But I don't state on my resume I have a strong background in comp sci (I don't).  My degree is in molecular biology, and I know I can deal with interviews along those lines.
19:20 rbuels pyrimidine: maybe now would be a good time to merge in the yapc10hackathon branch
19:21 rbuels i could do it
19:21 pyrimidine go for it.
19:21 rbuels and then you could look at that test in the context of the new fastq stuff
19:21 * pyrimidine covers eyes
19:21 * rbuels wires up the detonator
19:23 pyrimidine looks like the pastebot link is down in topic.  anyone have a preference for a backup?
19:24 rbuels pyrimidine: that pastebot has been down for a long time
19:24 Topic for #bioperlis now http://www.bioperl.org - You can get help here, but you must be patient. Ask your question and wait.
19:24 Topic for #bioperlis now http://www.bioperl.org - You can get help here, but you must be patient. Ask your question and wait. Paste to http://sial.org/pbot/
19:25 pyrimidine bah
19:25 * rbuels has done the merge, running tests now
19:27 rbuels ok, merge done
19:27 rbuels failing test is t/bugzilla/2847/bug.t
19:27 rbuels pyrimidine: ^^^^^^^^^
19:27 pyrimidine ok
19:30 pyrimidine I may parcel out the bugs into the specific test files they relate to.  I'll reopen the report on the one failing bug, may be an easy fix.
19:34 perl_splut one of our "programmers" was terminated from a project as he and the project lead couldn't communicate well about the needs for the group (russian speaker with chinese programmer...)
19:35 perl_splut as far as what one might want to know about biology from a CS point of view... most of that is the basics of things like DNA replication, RNA translation, etc...
19:36 pyrimidine rbuels: okay, replicated test fail on my end.  The example file is not valid FASTQ format (qual needs '+', not '@').  Fixing test case, and test passes.
19:36 rbuels hrm, where did they get that file then
19:36 * rbuels looks at bug
19:37 pyrimidine I
19:37 pyrimidine it's a demo file that probably worked with the old parser
19:38 rbuels yech.  alrightythen.
19:38 rbuels gonna close out that bug?
19:38 pyrimidine I suppose it was supposed to be a 'worst-case' example
19:39 pyrimidine bug closed
19:40 pyrimidine Don't know if you saw the news about the lead perl pumpking resigning (rgs)
19:40 pyrimidine http://consttype.blogspot.com/
19:42 rbuels oh i did
19:42 rbuels what exactly is blead?
19:42 pyrimidine bleadperl
19:42 rbuels i'm not familiar with the perl core devel process
19:43 pyrimidine http://www.perlfoundation.org/[…]dex.cgi?bleadperl
19:43 rbuels ah
19:43 * rbuels looks
19:44 pyrimidine The main issue is what features needed to be added to future perl releases
19:44 pyrimidine things that many users wanted were being turned down, like a class declarator, method signatures, etc
19:45 pyrimidine got to a point where he was just tired of it all
19:46 pyrimidine sad, but I don't blame him.  I don't agree with him but I understand where he is coming from
19:46 pyrimidine afk for a bit &

| Channels | #bioperl index | Today | | Search | Google Search | Plain-Text | plain, newest first | summary