| Time |
S |
Nick |
Message |
| 13:08 |
|
|
alper joined #bioperl |
| 15:30 |
|
|
pyrimidine joined #bioperl |
| 15:30 |
|
|
driley_ joined #bioperl |
| 15:31 |
|
pyrimidine |
bioperl-bot: translate 'gattaca' |
| 15:31 |
|
pyrimidine |
bioperl-bot-- |
| 15:32 |
|
deafferret |
tom cruise core dump |
| 15:32 |
|
deafferret |
err ethan hawke |
| 15:34 |
|
pyrimidine |
how do you call translate with bioperl-bot? |
| 15:35 |
|
deafferret |
bioperl-bot translate ACTAATAGATCTTAAGATCTTTATATAGATCTTCTTATTATTTTTACTATTAGGATCGCACTTTGCTGTG |
| 15:35 |
|
bioperl-bot |
TNRS*DLYIDLLIIFTIRIALCC |
| 15:35 |
|
deafferret |
<bioperl-bot> TNRS*DLYIDLLIIFTIRIALCC |
| 15:35 |
|
deafferret |
http://bioperl.org/wiki/Bots |
| 15:36 |
|
pyrimidine |
ok, no colon. Just making sure. |
| 15:53 |
|
pyrimidine |
bioperl-bot translate 'gataca' |
| 15:53 |
|
pyrimidine |
bioperl-bot translate gataca |
| 15:53 |
|
bioperl-bot |
DT |
| 15:53 |
|
pyrimidine |
hah! |
| 15:54 |
|
pyrimidine |
bioperl-bot's got the DT's |
| 15:56 |
|
|
Dr_ST joined #bioperl |
| 15:56 |
|
Dr_ST |
hi folks |
| 15:56 |
|
Dr_ST |
anyone familiar with bioperl + hmm? |
| 15:56 |
|
Dr_ST |
i have a little question conernning the profile retrieval |
| 15:57 |
|
Dr_ST |
how do i get the number of 'gaps' in a sequence? |
| 15:57 |
|
deafferret |
you might have to post some code samples of what you're attempting |
| 15:57 |
|
deafferret |
http://sial.org/pbot/ |
| 15:58 |
|
pyrimidine |
I think, within the HSP, you use 'no_gaps' (which is one of my least favorite method names) |
| 15:58 |
|
pyrimidine |
should be 'num_gaps' |
| 15:59 |
|
* deafferret |
laughs nervously |
| 15:59 |
|
pyrimidine |
could be worse, it could be 'numb_gaps' |
| 15:59 |
|
Dr_ST |
hum, ok i'll try to post some code on the lin |
| 15:59 |
|
Dr_ST |
k |
| 16:00 |
|
deafferret |
gap_count |
| 16:03 |
|
Dr_ST |
hum, i'm using this -> http://pastebin.mandriva.com/13544 |
| 16:04 |
|
Dr_ST |
(HMMER::Results) |
| 16:04 |
|
Dr_ST |
i've not entered in the HSP really, but i "think" i may have my code evolving since this gap fetaure is a problem |
| 16:05 |
|
Dr_ST |
moreover, i need the "total" number of gaps, but also if a gap is present in a subpart of the sequence ... |
| 16:05 |
|
pyrimidine |
Dr_ST: Are you using HMMER2 or HMMER3? the latter isn't supported yet. |
| 16:07 |
|
pyrimidine |
Dr_ST: Oh, I see, you're using the older Bio::Tools::HMMER. I suggest using Bio::SearchIO. |
| 16:09 |
|
pyrimidine |
Dr_ST: http://www.bioperl.org/wiki/HO[…]#Table_of_Methods |
| 16:09 |
|
pyrimidine |
Dr_ST: and the method to use is 'gaps' |
| 16:11 |
|
Dr_ST |
pyrimidine: ha, everything is merged in the seach::IO method now? great |
| 16:11 |
|
pyrimidine |
yes |
| 16:11 |
|
Dr_ST |
my code was started some time ago, and at that time, i was also "beginning" with bioperl |
| 16:12 |
|
pyrimidine |
Dr_ST: BLAST is the main one, but in general yes |
| 16:12 |
|
Dr_ST |
that's great, i'll see if i can "rapidly merge this into the existing code, i do not want to break a working, limited but, working |
| 16:12 |
|
Dr_ST |
ok |
| 16:13 |
|
Dr_ST |
i've sometimes problem to see if the method is doing it automatically or not, so i try to find what has the relevant keyword first |
| 16:13 |
|
Dr_ST |
+ i need to use "older" bioperl because i'm not administering the public server :-( |
| 16:13 |
|
Dr_ST |
thanks a lot, i'll see what i can do |
| 16:13 |
|
pyrimidine |
You should look at Sendu's hmmer_pull module, which is very fast and has the same implementations |
| 16:14 |
|
pyrimidine |
Oh, see here (about local bioperl): |
| 16:14 |
|
pyrimidine |
http://www.bioperl.org/wiki/In[…]SONAL_MODULE_AREA |
| 16:15 |
|
pyrimidine |
The SearchIO modules have only a few requirements (blastxml is the only XML-based SearchIO parser I think). Should be easy to download it and point PERL5LIB to it (or add a 'use lib' directive) |
| 16:16 |
|
Dr_ST |
i know this :-) |
| 16:16 |
|
Dr_ST |
i'm maintaining the bioperl port for mandriva, |
| 16:17 |
|
pyrimidine |
ok |
| 16:17 |
|
Dr_ST |
the problem is not to install bioperl on my own directory, the problem is to use it, but that's technical, if i have a good reason to ask for it, then i'll kick the sysadmin :-) |
| 16:17 |
|
Dr_ST |
hmm_pull is where ? |
| 16:18 |
|
Dr_ST |
found it |
| 16:18 |
|
Dr_ST |
i forgot the "er" |
| 16:19 |
|
pyrimidine |
well, the last release was in January and is considered stable: |
| 16:19 |
|
pyrimidine |
http://search.cpan.org/~cjfields/BioPerl-1.6.0/ |
| 16:20 |
|
pyrimidine |
I am cleaning up more bugs this month for a 1.6.x release (it may be 1.6.2, considering how bioperl-run is 1.6.1) |
| 16:22 |
|
Dr_ST |
ok, thanks again for the pointers, i cannot follow anymore the bioperl mailing list for now (too much traffic to add to the other mailing lists), but congrats for the tremendous work you are doing! |
| 16:23 |
|
pyrimidine |
thanks! |
| 16:30 |
|
rbuels |
pyrimidine: feel free to toss a release-blocking bug or two my way |
| 16:31 |
|
rbuels |
i will catch them out of the air and gobble them down like a trained seal. |
| 16:31 |
|
rbuels |
that smells of fish. |
| 16:31 |
|
pyrimidine |
eww |
| 16:31 |
|
* deafferret |
sniffs |
| 16:41 |
|
deafferret |
rbuels: I successfully failed to kill myself my first day on my 250cc dirt bike :) the extreme mudiness was partly resposible for my lower stupidity quotient |
| 16:43 |
|
rbuels |
lol |
| 16:44 |
|
rbuels |
when i was a teenager i knew a guy who successfully killed himself on a dirt bike. he was 14 or 15 at the time, i think |
| 16:45 |
|
rbuels |
his dad was not in good shape afterwards |
| 16:45 |
|
rbuels |
so be careful! |
| 16:45 |
|
deafferret |
not recommended |
| 16:45 |
|
rbuels |
and make your kids be careful! |
| 16:46 |
|
rbuels |
but that said, it sounds like fun. ;-) |
| 16:46 |
|
deafferret |
yup. always. we showed up right as a kid was leaving muttering something about 3rd gear, a stump, over the handlebars, and how do I know if it's a concussion |
| 16:47 |
|
deafferret |
that kid is about 80X more skilled + stupid than my son and I at this point :) |
| 16:52 |
|
|
perl_splut joined #bioperl |
| 17:03 |
|
pyrimidine |
Anyone here work primarily with ActivePerl/Windows? Want to get a PPM going? |
| 17:03 |
|
pyrimidine |
http://bugzilla.open-bio.org/show_bug.cgi?id=2794 |
| 17:41 |
|
|
pyrimidine joined #bioperl |
| 17:52 |
|
|
pyrimidine_ joined #bioperl |
| 18:18 |
|
|
rowlesd joined #bioperl |
| 18:38 |
|
deafferret |
rowlesd: you sound exactly like me 3 years ago :) |
| 18:39 |
|
deafferret |
I have a slew of "genetics for dummies" and books like that |
| 18:39 |
|
deafferret |
how strong is your perl? |
| 18:45 |
|
rowlesd |
It has been suggested to me that this would be a good place to direct a question, please excuse me if it isn't! |
| 18:46 |
|
deafferret |
:) this is the perfect place |
| 18:46 |
|
rowlesd |
I am an experienced perl programmer who last studied biology 15 years ago, and who is hoping to learn something about BioPerl |
| 18:47 |
|
pyrimidine_ |
ok |
| 18:47 |
|
rowlesd |
My problem is that the documentation looks excellent for Biologists who want to learn about Perl, but I have been unable to locate any resources for programmers who want to learn about Biology |
| 18:47 |
|
pyrimidine_ |
this place would work, though the mail list tends to get more response |
| 18:48 |
|
rowlesd |
Can anyone suggest a place I might go to try and learn more? |
| 18:49 |
|
pyrimidine_ |
An Introduction to Bioinformatics Algorithms (Computational Molecular Biology) |
| 18:50 |
|
pyrimidine_ |
Jones and Pevzner |
| 18:50 |
|
pyrimidine_ |
http://www.amazon.com/gp/product/0262101068 |
| 18:51 |
|
rowlesd |
Looks excellent - thank you very much |
| 18:52 |
|
pyrimidine_ |
rowlesd: that's written from the computational science perspective but gives you background on common tasks in comp. biology |
| 18:53 |
|
pyrimidine |
Another (classic) is Gusfield: Algorithms on Strings, Trees and Sequences: Computer Science and Computational Biology |
| 18:53 |
|
pyrimidine |
http://www.amazon.com/Algorith[…]98/ref=pd_sim_b_1 |
| 18:56 |
|
rowlesd |
Thank you :) |
| 19:03 |
|
rowlesd |
Thank you all very much for your help and suggested bedtime reading! |
| 19:04 |
|
rbuels |
rowlesd: i would not recommend reading that stuff at bedtime, if you want to get through much of it ;-) |
| 19:04 |
|
rbuels |
or maybe that's just me |
| 19:04 |
|
rbuels |
lol |
| 19:04 |
|
rowlesd |
Yep - looks pretty heavy going |
| 19:05 |
|
rbuels |
rowlesd: did you just get a position in a bio lab or something after working in 'normal' computer stuff? |
| 19:06 |
|
rowlesd |
Not quite - I've got an interview for a post, and it looks really interesting, but I'd like to understand the area I'd be working in and what I'd be doing a lot better |
| 19:09 |
|
rbuels |
hmm, textbooks might be overkill then |
| 19:10 |
|
rbuels |
maybe some quick introduction material about molecular bio or something? |
| 19:10 |
|
rbuels |
i would think that would be more enlightening than algorithms |
| 19:10 |
|
rbuels |
for interviewing purposes |
| 19:11 |
|
pyrimidine |
All depends |
| 19:11 |
|
rbuels |
yeah depends on the job i guess |
| 19:11 |
|
rbuels |
if rowlesd is getting hired out of industry though, he probably wouldn't be doing algorithms |
| 19:12 |
|
pyrimidine |
if they're hiring you for your computational background, then knowledge of algorithms is a plus |
| 19:12 |
|
pyrimidine |
actually, a few interviewers I know will ask if one knows how to write up a quick sort, just to gauge how much they know |
| 19:13 |
|
pyrimidine |
(i.e. lie on a resume, you might get caught out) |
| 19:13 |
|
rowlesd |
I've certainly done that myself when interviewing in the past! |
| 19:13 |
|
rbuels |
ugh. 'write a quick sort' is not a good interview question if you want to find a good productive programmer. |
| 19:14 |
|
rbuels |
code samples. |
| 19:14 |
|
pyrimidine |
weeds out those who say they are adept from those who really are |
| 19:14 |
|
rbuels |
have them code a solution to some kind of real-world-ish problem. |
| 19:14 |
|
pyrimidine |
but then why hire them? |
| 19:15 |
|
pyrimidine |
If you have the solution in hand, the problem is solved |
| 19:15 |
|
pyrimidine |
no need for the job ;) |
| 19:15 |
|
* pyrimidine |
committed another FASTQ fix |
| 19:16 |
|
rbuels |
there is no correlation between people who know a particular piece of programming trivia and people who will be productive programmers |
| 19:17 |
|
rbuels |
you can find out how to write a quick sort in 15 seconds using google |
| 19:17 |
|
rbuels |
you want people that know how to approach nontrivial problems, design solutions, etc |
| 19:17 |
|
pyrimidine |
True, but if you state on your resume you have a computer science background be ready for questions along those lines |
| 19:18 |
|
rbuels |
hah, my answer would be "that's not important" |
| 19:18 |
|
rbuels |
and if they persist in asking questions like that i would seriously reconsider whether i wanted to work at such a clueless place |
| 19:18 |
|
rbuels |
joel has a great guide about interviewing programmers: |
| 19:18 |
|
rbuels |
http://www.joelonsoftware.com/[…]nterviewing3.html |
| 19:19 |
|
pyrimidine |
I happen to agree with you BTW. But I don't state on my resume I have a strong background in comp sci (I don't). My degree is in molecular biology, and I know I can deal with interviews along those lines. |
| 19:20 |
|
rbuels |
pyrimidine: maybe now would be a good time to merge in the yapc10hackathon branch |
| 19:21 |
|
rbuels |
i could do it |
| 19:21 |
|
pyrimidine |
go for it. |
| 19:21 |
|
rbuels |
and then you could look at that test in the context of the new fastq stuff |
| 19:21 |
|
* pyrimidine |
covers eyes |
| 19:21 |
|
* rbuels |
wires up the detonator |
| 19:23 |
|
pyrimidine |
looks like the pastebot link is down in topic. anyone have a preference for a backup? |
| 19:24 |
|
rbuels |
pyrimidine: that pastebot has been down for a long time |
| 19:24 |
|
|
Topic for #bioperlis now http://www.bioperl.org - You can get help here, but you must be patient. Ask your question and wait. |
| 19:24 |
|
|
Topic for #bioperlis now http://www.bioperl.org - You can get help here, but you must be patient. Ask your question and wait. Paste to http://sial.org/pbot/ |
| 19:25 |
|
pyrimidine |
bah |
| 19:25 |
|
* rbuels |
has done the merge, running tests now |
| 19:27 |
|
rbuels |
ok, merge done |
| 19:27 |
|
rbuels |
failing test is t/bugzilla/2847/bug.t |
| 19:27 |
|
rbuels |
pyrimidine: ^^^^^^^^^ |
| 19:27 |
|
pyrimidine |
ok |
| 19:30 |
|
pyrimidine |
I may parcel out the bugs into the specific test files they relate to. I'll reopen the report on the one failing bug, may be an easy fix. |
| 19:34 |
|
perl_splut |
one of our "programmers" was terminated from a project as he and the project lead couldn't communicate well about the needs for the group (russian speaker with chinese programmer...) |
| 19:35 |
|
perl_splut |
as far as what one might want to know about biology from a CS point of view... most of that is the basics of things like DNA replication, RNA translation, etc... |
| 19:36 |
|
pyrimidine |
rbuels: okay, replicated test fail on my end. The example file is not valid FASTQ format (qual needs '+', not '@'). Fixing test case, and test passes. |
| 19:36 |
|
rbuels |
hrm, where did they get that file then |
| 19:36 |
|
* rbuels |
looks at bug |
| 19:37 |
|
pyrimidine |
I |
| 19:37 |
|
pyrimidine |
it's a demo file that probably worked with the old parser |
| 19:38 |
|
rbuels |
yech. alrightythen. |
| 19:38 |
|
rbuels |
gonna close out that bug? |
| 19:38 |
|
pyrimidine |
I suppose it was supposed to be a 'worst-case' example |
| 19:39 |
|
pyrimidine |
bug closed |
| 19:40 |
|
pyrimidine |
Don't know if you saw the news about the lead perl pumpking resigning (rgs) |
| 19:40 |
|
pyrimidine |
http://consttype.blogspot.com/ |
| 19:42 |
|
rbuels |
oh i did |
| 19:42 |
|
rbuels |
what exactly is blead? |
| 19:42 |
|
pyrimidine |
bleadperl |
| 19:42 |
|
rbuels |
i'm not familiar with the perl core devel process |
| 19:43 |
|
pyrimidine |
http://www.perlfoundation.org/[…]dex.cgi?bleadperl |
| 19:43 |
|
rbuels |
ah |
| 19:43 |
|
* rbuels |
looks |
| 19:44 |
|
pyrimidine |
The main issue is what features needed to be added to future perl releases |
| 19:44 |
|
pyrimidine |
things that many users wanted were being turned down, like a class declarator, method signatures, etc |
| 19:45 |
|
pyrimidine |
got to a point where he was just tired of it all |
| 19:46 |
|
pyrimidine |
sad, but I don't blame him. I don't agree with him but I understand where he is coming from |
| 19:46 |
|
pyrimidine |
afk for a bit & |
