Camelia, the Perl 6 bug

IRC log for #bioperl, 2009-09-11

| Channels | #bioperl index | Today | | Search | Google Search | Plain-Text | summary

All times shown according to UTC.

Time Nick Message
02:06 tarbo2 joined #bioperl
06:58 Hammit joined #bioperl
06:59 Hammit left #bioperl
12:14 balin joined #bioperl
13:05 kyanardag joined #bioperl
13:42 balin joined #bioperl
14:58 ptl joined #bioperl
15:14 kyanardag_ joined #bioperl
15:18 kyanardag joined #bioperl
15:30 kyanardag joined #bioperl
15:37 kyanardag joined #bioperl
15:39 kyanardag joined #bioperl
15:56 kyanardag joined #bioperl
16:33 bioperl-bot joined #bioperl
16:33 bioperl-bot Hi there.
16:53 pyrimidine joined #bioperl
17:18 ptl bioperl-bot: translate acgtaaaagctgagt
17:18 ptl translate acgtaaaagctgagt
17:18 ptl translate gattaca
17:18 ptl bleah.
17:22 deafferret bioperl-bot translate ACTAATAGATCTTAAGATCTTTATATAGATCTTCT​TATTATTTTTACTATTAGGATCGCACTTTGCTGTG
17:22 bioperl-bot TNRS*DLYIDLLIIFTIRIALCC
17:22 deafferret http://bioperl.org/wiki/Bots
17:25 pyrimidine bioperl-bot die
17:25 * pyrimidine couldn't kill bioperl-bot
17:26 deafferret /kick should work fine  :)
17:35 ptl bioperl-bot translate acgtaaaagctgagt
17:35 bioperl-bot T*KLS
18:18 ptl bioperl-bot translate WSNTGYAARTRRATGTAYTRRGCNYTNYTN​WSNTRRWSNACNCCNATHGAYTRRACNTRR
18:18 ptl CAYCCNGARTRRATHTRRGAYAAYACNTRR​AARATHTGYAARGARGAYTRRTTYMGNTRR
18:18 ptl oops.
18:19 ptl bioperl-bot translate WSNTGYAARTRRATGTAYTRRGCNYTNYTNWSNTRRWSNACNCCN​ATHGAYTRRACNTRRCAYCCNGARTRRATHTRRGAYAAYACNTRR​AARATHTGYAARGARGAYTRRTTYMGNTRRACNCAYATHWSN%
18:19 deafferret translate amino acids? o.O
18:22 ptl I thought it would detect it was aminoacids and reverse translate it
18:24 ptl bioperl-bot translate catatttaaagcaccccgattgattaaacctaaagctgc​aaataaatgtattaagcgctgctgagctaaatttaacat​ccggaataaatttaagataacacctaaggcgaaacctaa​gcgaacaacgaagattaatttcgctaaacccatattagc
18:24 bioperl-bot HI*STPID*T*SCK*MY*ALLS*I*H​PE*I*DNT*GET*ANNED*FR*THIS
18:25 * deafferret laughs
18:25 * deafferret hates getting anned
18:27 ptl lol
18:28 ptl it was 'hi stupid bot, suck my balls, I hope I don't get banned for this'... But I think you deciphered it :P
18:28 deafferret oh. in that case I'm deeply offended and must kickban you now
18:29 ptl :(
18:29 ptl go ahead... I'll close my eyes hoping it doesn't hurt
18:29 * deafferret starts quoting Pulp Fiction
18:30 ptl torture before pulling the trigger? bad bad ferret
18:30 deafferret Ezekiel 25:17: The path of the righteous man is beset on all sides by the inequities of the selfish and the tyranny of evil men. Blessed is he who, in the name of charity and good will, shepherds the weak through the Valley of Darkness; for he is truly his brother's keeper, and the finder of lost children. And, I will strike down upon thee with great vengeance and furious anger those who attempt to poison and destroy my brothers! And, you will k
18:38 was kicked by pyrimidine: pyrimidine
18:38 * pyrimidine rescues ptl
18:38 deafferret joined #bioperl
18:39 deafferret laugh... that didn't work as I expected  :)
18:45 ptl lol
18:49 pyrimidine deafferret: You a regular user of DBIx::Class?
18:49 * deafferret waits patiently for pyrimidine to leave so he can torture others
18:50 deafferret pyrimidine: sort of. in the simplest possible cases.
18:50 deafferret pyrimidine: DBIC does insanely complicated things. we use it sometimes for the simplest possible things only
18:50 deafferret it's convenient for single-table CRUD
18:51 deafferret i get nervous on table joins and hate SQL::Abstract
18:51 deafferret I like DBIx::Class::Schema::Loader, that's gold
18:52 pyrimidine I have to set up a local database to house expression data, but I may just use plain ol' DBI
18:52 deafferret -shrug- DBIC and DBI work happily side by side.
18:52 deafferret so I tend to DBIC things until they piss me off, then I DBI that part
18:52 pyrimidine Someone here set it up in *cough*Access*cough*
18:53 deafferret /kickbans that person
18:53 balin_ joined #bioperl
18:53 pyrimidine it's in terrible shape, but that's not her fault
18:55 pyrimidine lab hasn't been very helpful in filling in the gaps (exp. annotation, etc).  Was thinking about setting up something simple using DBIx::Class to help clean it up.
19:07 kyanardag joined #bioperl
19:11 vein joined #bioperl
19:43 deafferret pyrimidine: ya, I really like DBIC. but if it doesn't cooperate for a specific chunk of your code, punt to DBI sooner rather than later
19:43 deafferret $0.02
19:52 pyrimidine deafferret: Yes, thinking that'll probably be the case.  May design something simple initially, then switch over to DBI depending
20:00 deafferret wow. R + microarray = swap
20:01 deafferret [1] "Reading CEL Files & Extracting Intensities."
20:01 deafferret Error: cannot allocate vector of size 750.2 Mb
20:05 pyrimidine how many CEL files?
20:06 deafferret 53
20:06 deafferret not really sure what this is doing, or if it can be done smarter
20:07 deafferret AnalyzeTilingCelFiles()
20:09 pyrimidine You'll either have to go to a higher mem setup or use something like: http://www.bioconductor.org/packages/2.4/bi​oc/vignettes/affyPara/inst/doc/affyPara.pdf
20:10 pyrimidine I though I recall someone using an SQL-based method as well, can't recall
20:10 * pyrimidine alzheimer's setting in
20:11 deafferret ooo... i've got this big bored 2000 node cluster sitting here... will that help?  woot
20:12 deafferret ooo!!!
20:12 deafferret pyrimidine+++++++=
20:20 pyrimidine np
20:39 * pyrimidine thinking I will run into the same thing soonish, w/ ~400 arrays
20:40 * deafferret chokes, staggers
20:42 pyrimidine We're starting next-gen pretty heavily soon as well.
20:42 * pyrimidine about to drown in data
20:42 pyrimidine I'm heading out, grabbing a beer on the way home.  Let me know how that array work goes.
20:43 pyrimidine commuting &
20:43 deafferret "A computer cluster and the ayPara
20:43 deafferret package should be used when working with more than 200 microarrays."
20:43 * deafferret ponders
20:43 deafferret pyrimidine: let me know how that beer goes  :D
21:18 vein next gen is fun data to play with
22:56 kyanardag joined #bioperl
23:54 balin joined #bioperl

| Channels | #bioperl index | Today | | Search | Google Search | Plain-Text | summary