Camelia, the Perl 6 bug

IRC log for #bioperl, 2009-10-12

| Channels | #bioperl index | Today | | Search | Google Search | Plain-Text | summary

All times shown according to UTC.

Time Nick Message
04:02 ptl_ joined #bioperl
05:19 ende joined #bioperl
12:59 ende joined #bioperl
13:21 Biome joined #bioperl
13:21 Biome biome: Siddhartha Basu master SHA1-6162b96
13:21 Biome Revert "Location::Simple tests are passing now"
13:21 Biome http://bit.ly/16Sogf
13:21 Biome biome: Siddhartha Basu master SHA1-4289ab0
13:21 Biome The location_type validation is still not working during object creation
13:21 Biome http://bit.ly/vyB79
13:21 Biome biome: Siddhartha Basu master SHA1-00eab37
13:21 Biome Added split
13:21 Biome http://bit.ly/JTuzb
13:21 Biome left #bioperl
14:09 kyanardag_ joined #bioperl
14:56 ptl joined #bioperl
16:08 ptl joined #bioperl
16:17 deafferret tee hee ... bioperl++
16:17 deafferret features, locations
16:17 deafferret biology--
16:17 deafferret :D
16:17 deafferret god: you suck
16:23 * rbuels gives deafferret a tinfoil hat with a lightning rod on top
16:23 deafferret omnipotent ... but s/he has bad aim?
16:24 deafferret seriously, who designs mRNA like this?   TGTGTGCGTGTGCATTTATATGTGTGTGTGTGT​GTCTGTGTCTGTGTCCGTGGTTGTGTTTATGTT
16:24 deafferret crackhead
16:24 rbuels lol
16:24 * deafferret joined a tequila club over the weekend
16:25 * deafferret talked his brother into travelling to MX with him to see where it's made
16:29 deafferret hmm.... so i need the transcript position (not the genome position) of this last exon... /me rubs rbuel's chin
16:29 deafferret rbuel's   :)
16:29 rbuels i believe the correct english would be rbuels's
16:29 rbuels i don't think the s' form applies for proper names
16:30 deafferret pronounced rbuelzziziz
16:30 rbuels naturally
16:30 deafferret seriously? rbuels's ?
16:30 rbuels yeah i think so
16:30 deafferret me fail English? that's unpossible!
16:31 rbuels that's what my english teacher told me anyway
16:31 deafferret Ralph++
16:31 rbuels maybe she had a bottle of mexican tequila in her desk
16:31 rbuels i mean, we WERE in El Paso
16:31 deafferret shit, if anyone would know a PhD whose last name ends with an s should  :)
16:32 deafferret I was surprised to discover that expensive taquila is really smooth
16:32 deafferret you're all ed-you-ma-cated
17:46 ende joined #bioperl
17:48 * ende waves
17:51 deafferret hola. can I fetch you any UTRs today?  :)
17:51 deafferret i've got a whole stack of em here
17:57 deafferret deafferret: mRNA is not ambiguously "messenger" or "micro".  newb.  :p
18:07 ende haha
18:27 teneighty left #bioperl
20:07 * ptl google waves at ende
20:07 ende hey
20:10 ptl Does this interest someone? Sex differences, sexual selection, and ageing: an experimental evolution approach http://ow.ly/tUaK
20:33 ptl_ joined #bioperl

| Channels | #bioperl index | Today | | Search | Google Search | Plain-Text | summary