Camelia, the Perl 6 bug

IRC log for #bioperl, 2009-12-20

| Channels | #bioperl index | Today | | Search | Google Search | Plain-Text | summary

All times shown according to UTC.

Time Nick Message
00:18 brunov joined #bioperl
01:54 brunov joined #bioperl
04:40 driveby_bot joined #bioperl
04:40 driveby_bot /home/svn-repositories/bioperl: r16540 (cjfields) : Robson's patch for buggy blastpgp output
04:58 driveby_bot joined #bioperl
04:58 driveby_bot /home/svn-repositories/bioperl: r16541 (cjfields) : NSE now allows strand information, see thread: http://lists.open-bio.org/pipermail/​bioperl-l/2009-December/031772.html
05:55 driveby_bot joined #bioperl
05:55 driveby_bot /home/svn-repositories/bioperl: r16542 (cjfields) : Actually commit that last change
05:57 driveby_bot joined #bioperl
05:57 driveby_bot /home/svn-repositories/bioperl: r16543 (cjfields) : maf didn't conform to bp standard of -1,0,1 (used +/-)
05:59 driveby_bot joined #bioperl
05:59 driveby_bot /home/svn-repositories/bioperl: r16544 (cjfields) : maf tests now conform to expected output
06:03 driveby_bot joined #bioperl
06:03 driveby_bot /home/svn-repositories/bioperl: r16545 (cjfields) : tests now allow strandedness; add strand check for those seqs that are now changed
06:10 driveby_bot joined #bioperl
06:10 driveby_bot /home/svn-repositories/bioperl: r16546 (cjfields) : missing comma
12:31 brandi joined #bioperl
13:26 brandi joined #bioperl
14:22 brunov joined #bioperl
15:33 brunov anyone know anything about irc?
15:33 brunov I wrote a bioperl bot, worked fine in irc.perl.org, but it won't connect to freenode :(
15:53 brandi left #bioperl
16:33 mini-brunov joined #bioperl
16:34 bioperl-bot joined #bioperl
16:34 brunov channel, say hi to
16:34 brunov <suspense>
16:35 brunov BIOPERL-BOT!! :D
16:35 brunov bioperl-bot, karma bioperl
16:35 bioperl-bot brunov: bioperl has karma of 1.
16:35 brunov bioperl++
16:35 brunov bioperl-bot, karma bioperl
16:35 bioperl-bot brunov: bioperl has karma of 2.
16:35 brunov bioperl-bot, help
16:35 bioperl-bot brunov: Ask me for help about: dnatools, join, message, karma, seen, infobot, loader, title, rss, eval (say 'help <modulename>').
16:35 brunov bioperl-bot, help dnatools
16:35 bioperl-bot brunov: Various tools for DNA sequences: translation, reverse complement, composition, etc.
16:35 bioperl-bot ..Usage:
16:35 bioperl-bot ..
16:35 bioperl-bot ..    translate   <seq> [FRAME] # Translates DNA to protein
16:35 bioperl-bot ..    composition <seq>         # Base pair composition
16:35 bioperl-bot ..    revcomp     <seq>         # Reverse complement
16:35 bioperl-bot ..    reverse     <seq>         # Reverse
16:36 bioperl-bot ..    complement  <seq>         # Base pair complement
16:36 brunov \o/
16:36 brunov isn't this cool? Let's try it!
16:36 brunov translate GAATTCCGAAGGCCT
16:36 bioperl-bot EFRRP
16:36 brunov revcomp GAATTTTTTTCCCC
16:36 bioperl-bot GGGGAAAAAAATTC
16:36 brunov composition GGATTACCGATTCGATCCGAGC
16:36 bioperl-bot A:22.7% C:27.3% G:27.3% T:22.7%
16:37 brunov bioperl-bot, seen brunov
16:37 bioperl-bot brunov: brunov was last seen in #bioperl 0 seconds ago saying "seen brunov".
16:38 brunov bioperl-bot, tell deafferret that I'm the new #bioperl bot. Try me!
16:38 bioperl-bot brunov: OK. I'll deliver the message.
16:39 brunov http://bioperl.org
16:39 bioperl-bot [ BioPerl ]
16:39 brunov bioperl-bot, bioperl is awesome
16:39 bioperl-bot brunov: Okay.
16:39 brunov bioperl-bot, bioperl is also better than bioruby
16:39 bioperl-bot brunov: Okay.
16:39 brunov bioperl-bot, bioperl?
16:39 bioperl-bot brunov: bioperl is awesome or better than bioruby
16:39 brunov lol
16:40 brunov translate ATGATGATGATG
16:40 bioperl-bot MMMM
16:40 brunov translate ATGATGATGATG 1
16:40 bioperl-bot ***
16:40 brunov translate ATGATGATGATG 2
16:40 bioperl-bot DDD
16:40 brunov translate asl;dkjf;laskdfjasdl
16:40 bioperl-bot If that's supposed to represent a polymer of nucleotides, then I'm the digital reincarnation of Evita.
16:41 brunov :D
16:44 brunov bioperl-bot, be deaferret is <action>feeds the phant
16:44 bioperl-bot brunov: Okay.
16:44 brunov bioperl-bot, be deaferret?
16:44 * bioperl-bot feeds the phant
16:49 brunov
16:49 brunov translate AGGGG
16:49 bioperl-bot [ ilbot - Irc log bot in Perl ]
16:53 brandi1 joined #bioperl
17:42 brunov AGGGGG
17:42 brunov translate ^^
17:42 bioperl-bot If that's supposed to represent a polymer of nucleotides, then I'm the digital reincarnation of Evita.
19:01 bioperl-bot joined #bioperl
19:03 brunov bioperl-bot, help
19:03 bioperl-bot brunov: Ask me for help about: dnatools, join, message, karma, seen, infobot, loader, title, rss, eval (say 'help <modulename>').
19:03 brunov bioperl-bot, help dnatools
19:03 bioperl-bot brunov: Various tools for DNA sequences: translation, reverse complement, composition, etc.
19:03 bioperl-bot ..Usage:
19:03 bioperl-bot ..
19:03 bioperl-bot ..    translate   <seq> [FRAME] # Translates DNA to protein
19:03 bioperl-bot ..    composition <seq>         # Base pair composition
19:03 bioperl-bot ..    revcomp     <seq>         # Reverse complement
19:03 bioperl-bot ..    reverse     <seq>         # Reverse
19:03 bioperl-bot ..    complement  <seq>         # Base pair complement
19:03 bioperl-bot ..    tm          <seq>         # Calculate the melting temperature
19:03 brunov tm GGGGGGGGGGGGGGGGGGGGGGGGGGG
19:03 bioperl-bot 85.92 ºC
19:24 brunov bioperl-bot, join #perl
19:24 bioperl-bot brunov: Ok.
19:31 bioperl-bot joined #bioperl
19:32 brunov look ma, nested calls!
19:32 brunov composition reverse complement GAAAGGCCGGTTT
19:32 bioperl-bot A:23.1% C:38.5% G:15.4% T:23.1%
19:32 brunov tm GGGGGGGGGGGGGGG
19:32 bioperl-bot 65.25 ºC
19:32 brunov tm complement GGGGGGGGGGG
19:32 bioperl-bot 49.08 ºC
19:32 brunov complement GGGGGGGGGg
19:32 bioperl-bot CCCCCCCCCc
19:33 brunov composition complement GGGGGGGGGGGGGGg
19:33 bioperl-bot C:100.0%
19:33 brunov translate reverse complement GAATTGGCCGGTT
19:33 bioperl-bot NRPI
19:33 brunov :D
19:33 brunov bioperl-bot++
19:33 bioperl-bot brunov: Thanks!
19:37 brunov translate your momma
19:37 bioperl-bot If that's supposed to represent a polymer of nucleotides, then I'm the digital reincarnation of Evita.
19:37 brunov translate your momma
19:37 bioperl-bot I.. I think that's not quite right.
19:37 brunov translate your momma
19:37 bioperl-bot I.. I think that's not quite right.
19:37 brunov translate your momma
19:37 bioperl-bot No, no NOOO! Horrible input. I'm ashamed for both of us.
19:45 brunov perl eval print 'foo'
19:45 bioperl-bot 'print' trapped by operation mask at (eval 1094) line 2.
19:45 brunov uhm
20:02 bioperl-bot joined #bioperl
20:30 bag joined #bioperl
20:38 bioperl-bot joined #bioperl
20:39 brunov bioperl-bot, translate GAAATTC
20:39 bioperl-bot brunov: EI
20:39 brunov translate foo
20:39 brunov bioperl-bot++
20:39 bioperl-bot brunov: Thanks!
21:00 brunov bioperl-bot, tm CGGAACGGTTGGGCCCCGG
21:00 bioperl-bot brunov: 65.64 ºC
21:35 gazda_ joined #bioperl
22:31 brunov cpan++
22:31 brunov karma cpan
22:31 bioperl-bot cpan has karma of 0.
22:31 brunov cpan++
22:31 brunov karma cpan
22:31 bioperl-bot cpan has karma of 0.
22:31 brunov bioperl-bot--
22:31 bioperl-bot brunov: Pbbbbtt!
22:31 brunov karma bioperl-bot
22:31 bioperl-bot bioperl-bot has karma of 2.

| Channels | #bioperl index | Today | | Search | Google Search | Plain-Text | summary