Camelia, the Perl 6 bug

IRC log for #bioperl, 2010-06-30

| Channels | #bioperl index | Today | | Search | Google Search | Plain-Text | summary

All times shown according to UTC.

Time Nick Message
00:50 brandi joined #bioperl
00:50 brandi left #bioperl
02:01 dnewkirk joined #bioperl
02:42 vladc joined #bioperl
03:13 vladc Hi, I'm trying to find the sequences of the 18S rRNA in human and dog. Can anyone point me to where I can find these?
03:16 deafferret i've got human laying around somewhere. never done anything with dog
03:22 vladc deafferret: Thanks, can you point me to the human sequence?
03:23 deafferret k... lemme find it
03:24 vladc deafferret: OK, thanks!
03:28 deafferret 18S GTAGTCATATGCTTGTCTC TCCGCAGGTTCACCTACGGA
03:29 deafferret huh... organism not labelled in this source code   :/
03:29 deafferret is it ever different?
03:29 deafferret I have an unlabelled one, and one labelled Fungi, and their identical
03:29 deafferret that's all I know
03:30 deafferret (those are the primers, btw, not the product)
03:30 deafferret in-silico PCR for the products in any genome you want, I suppose
03:30 vladc deafferret: I've heard that it is very conserved in all eukaryotes. This sequence is a great lead that I can Blast to find matches. Thanks a lot!
03:30 deafferret sure. enjoy  :)
04:24 vladc left #bioperl
05:56 XaeroOne joined #bioperl
10:14 Xaero joined #bioperl
10:31 bag_ joined #bioperl
10:41 XaeroOne joined #bioperl
11:46 XaeroOne joined #bioperl
12:23 randomubuntuguy joined #bioperl
12:54 brandi joined #bioperl
13:01 grandmoun joined #bioperl
13:21 brandi left #bioperl
14:04 CIA-95 bioperl-live: Chris Fields topic/species_proxy * r11c21fa / t/Species.t : move check for Leaktrace into BEGIN, then skip if needed - http://bit.ly/9YtGy6
14:05 grandmoun left #bioperl
14:08 CIA-95 bioperl-live: Chris Fields topic/species_proxy * r0917504 / t/Species.t : require, not use (I always screw that up) - http://bit.ly/dpDbpZ
14:31 randomubuntuguy joined #bioperl
15:12 deafferret ..o.o..O    8.
15:17 XaeroOne what does that look like ^?
15:23 deafferret it's a long story. basically it means "I've been away from keyboard for a while but I'm back now."  :)
15:24 deafferret rbuels stopped being silly in here though, so it may be deprecated
16:21 CIA-95 bioperl-live: Chris Fields topic/species_proxy * r4ea2968 / t/Species.t : switch to Test::Weaken, optionally run - http://bit.ly/9qUggb
16:25 CIA-95 bioperl-live: Chris Fields topic/species_proxy * rf4fc350 / t/Species.t : fix skip test number - http://bit.ly/b3fDl0
16:40 brandi joined #bioperl
16:40 brandi left #bioperl
17:00 jhamilton joined #bioperl
17:33 pyrimidine joined #bioperl
18:04 CIA-95 bioperl-db: Chris Fields master * re56b757 / .gitignore : add minimal .gitignore file - http://bit.ly/9veyCe
18:07 CIA-95 bioperl-db: Chris Fields master * ra98d2d5 / .gitignore : ignore conf file - http://bit.ly/cXkk1z
18:07 CIA-95 bioperl-db: Chris Fields master * r4774e1f / lib/Bio/DB/Query/QueryConstraint.pm : squash perl 5.12 warning - http://bit.ly/aHDZX0
18:08 CIA-95 bioperl-live: Chris Fields topic/species_proxy * rabf0d5f / Bio/Tree/Node.pm : make sure only defined values are passed on - http://bit.ly/cOP483
18:25 CIA-95 bioperl-live: Chris Fields master * r0b508d2 / (16 files in 6 dirs): remove microarray-specific code into either bioperl-microarray(deprecated) or Bio-Microarray (ReSeq code) - http://bit.ly/cBeGRl
18:25 CIA-95 bioperl-live: Chris Fields master * r3cd6abb / Build.PL : remove dependencies - http://bit.ly/9QJ4At
18:25 CIA-95 bioperl-live: Chris Fields master * rf9978d6 / MANIFEST : update MANIFEST - http://bit.ly/cLuje7
18:25 CIA-95 bioperl-live: Chris Fields master * r1a43589 / (Changes DEPRECATED):
18:25 CIA-95 bioperl-live: add documentation on code move
18:25 CIA-95 bioperl-live: Signed-off-by: Chris Fields <cjfields@bioperl.org> - http://bit.ly/bMszJG
18:35 kyanardag joined #bioperl
18:41 * deafferret manifests the deprecations
19:16 newtobioperl joined #bioperl
20:09 CIA-95 bioperl-live: Chris Fields topic/species_proxy * r038a040 / Bio/Species.pm : [bug 3014] passed values should be defined, default to empty string - http://bit.ly/aclCe3
20:09 dnewkirk joined #bioperl
20:22 newtobioperl hey Dnewkirk, how are you?
20:24 dnewkirk doing well
20:24 dnewkirk happily coding in.. not Perl :)
20:25 deafferret not Perl makes me sad  :(
20:25 newtobioperl haha
20:25 dnewkirk would it be worse if I said it was Python :p
20:25 newtobioperl i am working on Blat and its parser :)
20:25 dnewkirk nice
20:25 dnewkirk hows that coming along?
20:25 newtobioperl dnewkirk is working on Biopython
20:26 deafferret if Python makes whatever you're doing easy -- GREAT!
20:26 deafferret is there a #biopython?
20:26 newtobioperl i believe so
20:26 newtobioperl i dont know about that
20:26 dnewkirk Its what was requested for this project, as part of a large pipeline
20:26 dnewkirk yes deafferret
20:26 newtobioperl BLAT is cool. Everyone should try it
20:28 newtobioperl do you guys know how I can create a Visual Map (like Google Map) that has zoom in zoom out function from PSL or BLAST output?
20:30 CIA-95 bioperl-live: Chris Fields master * r7d49494 / t/SeqFeature/Clone.t : squash warning - http://bit.ly/9dAuQG
20:44 kblin deafferret: though biopython is pretty empty and boring
20:44 deafferret I remain generally under the impression that bioperl is the most flushed out, by far
20:44 kblin er #biopython
20:44 kblin that as well
20:45 kblin BioRuby is the most barebone one
20:45 dnewkirk definitely
20:45 deafferret a couple years ago I said "woot! BioErlang!!" and it was ... maybe 3 hours worth of code, total  :)
20:45 kblin I've never really looked at BioJava
20:46 dnewkirk each has a slightly different fosu though
20:46 deafferret whereas bioperl has 10 years of hundreds of disparate focii  :)
20:47 deafferret of various levels of abandonment  :)
20:47 kblin ah, focus
20:47 kblin I was just wondering about fosu
20:47 kblin and only found a city in ghana
20:48 deafferret deafferret: Back to $work[0]! These room types aren't going to upgrade themselves!
20:48 kblin a partner in our current project works in python. not biopython, though
20:49 newtobioperl how come we dont have a forum for bioperl?
20:49 kblin we've got a mailing list and irc
20:49 newtobioperl i dont really like mailing lists lol
20:49 * deafferret dislikes web forums
20:49 kblin in my experience, most mailing-listy and IRCy projects don't do forums
20:50 deafferret and email is just gross   :)
20:50 newtobioperl its hard to keep track of things
20:50 deafferret everything should be a github repo/issues  !  :)
20:50 newtobioperl lol
20:50 kblin newtobioperl: on a forum, I totally agree ;)
20:50 deafferret also, Mediawiki++
20:51 deafferret Talk: pages on Mediawiki for the win
20:51 newtobioperl it would be much easier for a newbie like me find info on Bioperl if we have a forum
20:52 deafferret searching the wiki doesn't help? search.cpan.org? google?
20:52 newtobioperl it helps but not that easy
20:52 newtobioperl :)
20:52 deafferret what is a web forum other than an annoying interface to an email list, overrun with too-cute icons?
20:53 deafferret what we need is a law forcing everyone into IRC!
20:53 newtobioperl cute thumbnail pics
20:53 * deafferret starts a petition
20:54 dnewkirk forums are where you go to waste time bickering about things no one cares about or people care about too much.
20:54 dnewkirk other than seqanswers, most forums are a flop
20:55 * deafferret disagrees        (just to be funny)
20:55 newtobioperl yes
20:55 deafferret dnewkirk: you're a flop!
20:55 dnewkirk thats true, but irrelevant :)
20:55 * deafferret demands satisfaction
20:55 newtobioperl well, we will have a Flop section in the forum
20:55 deafferret rbuels: you're missing some serious silly!
20:56 deafferret FlopSweat, the BioPerl Forum
20:56 rbuels deafferret: there's plenty of silly at #ievobio
20:56 newtobioperl dnew is gonna be the Mod in that FLop forum
20:56 deafferret wazzat?
20:56 rbuels http://twitter.com/#search?q=%23ievobio
20:56 dnewkirk cohesin
20:56 dnewkirk oops :p
20:57 deafferret uh... what does 'ievobio' mean?
20:58 dnewkirk it means their evolving apple users?
20:58 deafferret http://ievobio.org/ ?
20:59 deafferret so... Jeff Mitton is a shape-shifter?
21:04 newtobioperl hmm... In the future we will have a robot that can do coding for us
21:06 CIA-95 bioperl-run: Chris Fields master * r8283ed1 / (5 files in 4 dirs): Merge branch 'master' of github.com:bioperl/bioperl-run - http://bit.ly/9cDpKF
21:06 CIA-95 bioperl-run: Chris Fields master * rf1d3d58 / t/Cap3.t : skip test count off, fixed - http://bit.ly/aLhH7X
21:06 CIA-95 bioperl-run: Chris Fields master * rb5bc8c1 / (t/Newbler.t t/Phrap.t t/TigrAssembler.t): correct skipped number of tests - http://bit.ly/cQqxZS
21:07 newtobioperl how come I dont have Bio::Graphics, do you guys know what CPAN address of Bio::Graphics?
21:08 newtobioperl nvm, i got it
21:08 deafferret :)
21:15 newtobioperl sigh
21:15 newtobioperl can't install Bio::SCF
21:15 newtobioperl on my window
21:16 deafferret I haven't convinced you to use Linux yet?  :)
21:16 newtobioperl window is my 1st love
21:16 newtobioperl hard to let my baby go
21:17 newtobioperl lol
21:17 newtobioperl ok, i gotta find a linux
21:20 deafferret a small Amazon EC2 instance costs $60/month
21:20 deafferret or linnode.com
21:20 deafferret linode.com sorry
21:20 CIA-95 bioperl-run: Chris Fields master * r85e3f09 / (5 files in 2 dirs): add email - http://bit.ly/d1Dko3
21:22 newtobioperl ha!!! have you ever used GBrowse???
21:23 newtobioperl http://gmod.org/wiki/GBrowse
21:23 deafferret http://biobase2.ist.unomaha.edu/gbrowse2/
21:24 deafferret we were just talking about one of our installs, yes
21:25 newtobioperl what is the different between BIO::Graphics and Gbrowse?
21:25 deafferret scope
21:25 newtobioperl i see
21:26 newtobioperl then Gbrowse it is
21:26 deafferret GBrowse is a browser. It lets you click around. GBrowse uses Bio::Graphics to generate the actual .png files
21:26 newtobioperl lol I dont have to buy Linux yet
21:26 deafferret no, you *want* to bux Linux   :)
21:29 CIA-95 bioperl-run: Chris Fields master * r17270dd / t/Bowtie.t : add ulimit -n check, as these tests fail from too many open filehandles (bug 2577) - http://bit.ly/9OIhS4
21:29 newtobioperl My lab is about 30 mins away from my house
21:29 newtobioperl they have MAC OSX there
21:29 newtobioperl but i am too lazy to drive there
21:29 newtobioperl :)
21:31 CIA-95 bioperl-run: Chris Fields master * r949e2ad / .gitignore : add minimal gitignore - http://bit.ly/a2ybga
21:48 CIA-95 bioperl-run: Chris Fields master * r148ece7 / t/EMBOSS.t : fix odd verbosity-dependent bug with EMBOSS tests - http://bit.ly/bD4UO0
22:00 dnewkirk um, you don't have to 'buy' linux at all ;)
22:01 dnewkirk ahh, but you want it remotely available, I see, nm
22:05 jhamilton joined #bioperl
22:08 newtobioperl can I install Ubuntu on my window 7 desktop?
22:14 newtobioper joined #bioperl
22:14 newtobioper sorry i got disconnected
22:14 newtobioper what is the good Linux OS ?
22:18 deafferret I like Ubuntu
22:18 deafferret it's a "distribution"
22:19 deafferret there are hundreds of linux "distributions" : http://distrowatch.com/
22:20 newtobioper lol thanks
22:46 CIA-95 bioperl-run: Chris Fields master * r50e6eda / t/EMBOSS.t : align left - http://bit.ly/9xfGnS
22:46 CIA-95 bioperl-run: Chris Fields master * r959d4e2 / lib/Bio/Tools/Run/Primer3.pm : add version() (backport from primer3redux) - http://bit.ly/bVVQce
22:46 CIA-95 bioperl-run: Chris Fields master * rb46abd7 / t/Primer3.t : skip if version greater than 1.2 (old primer3 code) - http://bit.ly/dyttom
22:52 dnewkirk what deafferret? You didn't send him off to install Gentoo and compile his own kernel?
22:57 deafferret sudo dnewkirk ssh newtobioper ./configure
22:57 dnewkirk :)
22:57 deafferret linode seems cool. $20/month, installing my CPAN stack now
22:58 deafferret linode.com + Ubuntu ++
22:59 CIA-95 bioperl-run: Chris Fields master * r6d7b6dc / t/Blat.t : is(), not ok() - http://bit.ly/cOUpHV
23:06 CIA-95 bioperl-run: Chris Fields master * r5d97c44 / t/Bowtie.t : more robust call to ulimit - http://bit.ly/aLtr2J
23:09 CIA-95 bioperl-run: Chris Fields master * r9b9181c / (lib/Bio/Tools/Run/Cap3.pm lib/Bio/Tools/Run/Maq.pm): some tweaks to get rid of warnings - http://bit.ly/adhHbq
23:13 newtobioper working on Blat parser :)
23:14 newtobioper much better without bioperl on this one lol
23:17 deafferret so you got blat working by itself now?
23:18 CIA-95 bioperl-run: Chris Fields master * r75cddb2 / (7 files): no_sequences -> num_sequences - http://bit.ly/bQ6bD2
23:20 newtobioper yes
23:20 newtobioper on WINDOW
23:21 newtobioper deafferret, you should try it on your Human database to see how long it takes
23:21 newtobioper lol
23:24 deafferret :)
23:58 newtobioper what bioperl module allows you to search a sequence if you know start-end position???
23:58 dnewkirk SeqIO
23:59 deafferret dnewkirk: huh? SeqIO is just a parser. it doesn't search anything
23:59 deafferret newtobioper: define 'search'
23:59 newtobioper i was reading something about Flat the other day
23:59 newtobioper like cut a sequence
23:59 newtobioper at start-end position
23:59 dnewkirk Your right. I do have it incorporated into a search script though, sorry

| Channels | #bioperl index | Today | | Search | Google Search | Plain-Text | summary