Camelia, the Perl 6 bug

IRC log for #bioruby, 2013-09-14

| Channels | #bioruby index | Today | | Search | Google Search | Plain-Text | summary

All times shown according to UTC.

Time Nick Message
04:10 biorelated joined #bioruby
06:58 biorelated joined #bioruby
12:39 biorelated joined #bioruby
16:11 biorelated joined #bioruby
16:36 biorelated joined #bioruby
17:29 biorelated joined #bioruby
18:20 biorelated joined #bioruby
19:12 biorelated joined #bioruby
20:41 biorelated joined #bioruby
23:13 shevy is there a find-gene functionality in BioRuby? like "UUUGAUGUCGCUUGCGCUGAUAAUAAUAAAUAA" should find a gene in it?

| Channels | #bioruby index | Today | | Search | Google Search | Plain-Text | summary