Perl 6 - the future is here, just unevenly distributed

IRC log for #perl6, 2011-03-09

Perl 6 | Reference Documentation | Rakudo

| Channels | #perl6 index | Today | | Search | Google Search | Plain-Text | summary

All times shown according to UTC.

Time Nick Message
00:01 cdarroch left #perl6
00:02 hercynium joined #perl6
00:02 benabik joined #perl6
00:05 nymacro joined #perl6
00:07 nymacro left #perl6
00:09 nymacro joined #perl6
00:17 shi left #perl6
00:20 tyatpi_ left #perl6
00:28 wallberg left #perl6
00:29 jaldhar left #perl6
00:30 jaldhar joined #perl6
00:31 porter235 joined #perl6
00:35 porter235 left #perl6
00:45 plobsing left #perl6
00:56 plobsing joined #perl6
01:08 gdey_ left #perl6
01:18 plobsing left #perl6
01:23 lichtkind left #perl6
01:29 jevin left #perl6
01:30 gdey_ joined #perl6
01:40 woosley joined #perl6
01:45 sorear good * #perl6
01:50 plobsing joined #perl6
01:54 diakopter *
02:00 noganex joined #perl6
02:01 Util o/
02:02 donri left #perl6
02:04 noganex_ left #perl6
02:06 cotto joined #perl6
02:09 gdey_ left #perl6
02:09 mizerydearia left #perl6
02:10 gdey_ joined #perl6
02:11 mizerydearia joined #perl6
02:11 colomon \o
02:11 gdey_ left #perl6
02:12 whiteknight left #perl6
02:13 gdey_ joined #perl6
02:13 mizerydearia left #perl6
02:13 gimix joined #perl6
02:17 mtk left #perl6
02:21 hercynium left #perl6
02:25 mtk joined #perl6
02:31 porter235 joined #perl6
02:35 porter235 left #perl6
02:49 stkowski left #perl6
02:54 jferrero left #perl6
03:08 patspam_ joined #perl6
03:09 cotto left #perl6
03:13 patspam_ left #perl6
03:14 cotto joined #perl6
03:15 Woody_ left #perl6
03:22 patspam__ joined #perl6
03:42 colomon rakudo: <a c g t>.roll(100).say;
03:42 p6eval rakudo 3680ac: OUTPUT«taaatatattgtttcatagtcgtaccacccaacacattgtcctcacgcataaccggcggctcgtggctttctgtagaccgaatcttcgctgtttgctctg␤»
03:42 dalek specs: 65912c8 | sorear++ | S12-objects.pod:
03:42 dalek specs: Fix typo declaratoins
03:42 dalek specs: review: https://github.com/perl6/specs/commit/65912c88d9
03:43 sorear I wonder how many different values that line can print.
03:45 * TimToady thinks it's 4 ** 100
03:45 TimToady pugs: say 4 ** 100
03:45 p6eval pugs: OUTPUT«1606938044258990275541962092341162602522202993782792835301376␤»
03:46 sorear I have my doubts that the Parrot RNG is that good.
03:47 TimToady well, one *can* give rakudo a better RNG, in which case that line *can* print more values :)
03:51 sorear parrot rng isn't *too* horrible
03:51 sorear it's a linear congruential generator with 32 bit seeding and a 48 bit state
03:53 TimToady the digits of pi are pretty random
03:53 colomon I bet parrot will have a better rng before you get all 4 ** 100 results printed out.  ;)
03:54 colomon afk # desperate need of sleep.  will try to get sorear++'s percentage benchmark graph suggestion up and running tomorrow.
03:58 s1n left #perl6
04:02 sjohnson left #perl6
04:04 satyavvd joined #perl6
04:09 s1n joined #perl6
04:14 patspam__ left #perl6
04:23 Su-Shee_ joined #perl6
04:27 Su-Shee left #perl6
04:29 JimmyZ joined #perl6
04:29 VX64Z left #perl6
04:32 porter235 joined #perl6
04:36 porter235 left #perl6
05:13 cottoo joined #perl6
05:15 cotto left #perl6
05:16 JimmyZ left #perl6
05:22 mberends joined #perl6
05:25 cottoo left #perl6
05:32 orafu left #perl6
05:33 orafu joined #perl6
05:37 orafu left #perl6
05:41 orafu joined #perl6
05:45 kaare_ joined #perl6
05:56 justatheory left #perl6
06:03 sjohnson joined #perl6
06:19 fhelmberger joined #perl6
06:32 porter235 joined #perl6
06:36 porter235 left #perl6
06:37 GinoMan left #perl6
06:45 woosley1 joined #perl6
06:45 woosley left #perl6
06:46 wtw joined #perl6
06:47 woosley1 left #perl6
06:48 dual left #perl6
06:53 dual joined #perl6
06:59 mberends left #perl6
07:04 nymacro left #perl6
07:08 nymacro joined #perl6
07:16 eternaleye_ is now known as eternaleye
07:20 sorear ah, the Parrot entropy source is seconds-after-Epoch
07:20 jdhore sorear, Out of curiousity, what made you choose the CLR as the backend for your P6 implementation?
07:20 sorear diakopter++ recommended it to me
07:21 sorear also niecza was (very, very briefly) a fork of diakopter's perlesque
07:21 gdey_ left #perl6
07:21 jdhore ah
07:21 sorear I'm quite happy with it, btw.
07:27 sorear to @Larry: consider class A { proto method foo($x) {*} }; class B is A { method foo(1) {} }; class C is A { method foo(2) {} }; class D is B is C {}
07:27 sorear ; D.foo(2);
07:28 sorear a very literal reading of S12:1029 suggests that this should fail
07:28 sorear because D's body scope does not have a foo multi, no foo dispatch is created
07:28 sorear therefore the foo dispatch is inherited from B following the MRO
07:28 Chillance joined #perl6
07:29 sorear but B's foo dispatch has a wired-in dispatch list that includes only multis visible in B's MRO
07:29 jaldhar left #perl6
07:29 sorear excluding the multi in C
07:29 sorear is this *really* correct?
07:34 jaldhar joined #perl6
07:48 Mowah joined #perl6
07:57 am0c joined #perl6
08:02 aesop left #perl6
08:10 woosley joined #perl6
08:20 am0c left #perl6
08:22 moritz_ good morning
08:32 porter235 joined #perl6
08:33 Alias joined #perl6
08:34 aesop joined #perl6
08:39 porter235 left #perl6
08:39 moritz_ rakudo: say (-10..10).perl
08:39 p6eval rakudo 3680ac: OUTPUT«-10..10␤»
08:49 bacek joined #perl6
09:10 Su-Shee_ is now known as Su-Shee
09:12 jnthn morning, #perl6
09:13 daxim joined #perl6
09:13 tadzik morning
09:13 moritz_ \o
09:14 tadzik jnthn: http://nopaste.snit.ch/36414 mind taking a look in some spare time?
09:14 moritz_ tadzik: which branch?
09:15 tadzik master
09:15 tadzik alike on ctmo though
09:15 tadzik bbs
09:18 moritz_ anybody got an opinion on https://github.com/rakudo/rakudo/pull/19 ?
09:19 moritz_ to me it seems wrong
09:19 moritz_ if the user needs to set an env variable to properly use the version control system, shouldn't the user set that variable?
09:19 moritz_ or is that special-cased in that weird make?
09:28 jmm_ I'm looking at avalaibles modules on perl6.org, and notice gamebase, which seems to use perl5 SDL. am I wrong ? there is a SDL port to perl6 ?
09:30 moritz_ jmm_: it uses parrot's SDL bindings
09:31 jmm_ umm.
09:31 moritz_ what's "umm." about it? :-)
09:33 tadzik moritz_: I'd like to somehow integrate the module API service (http://feather.perl6.nl:3000/) with modules.perl6.org in the near time. What does modules.perl6.org run on, it's a plain html with a cronjob? Where does it live?
09:33 dakkar joined #perl6
09:33 jmm_ hehe, I wonder what are those parrot binding, and what will happen if you run your program with rakudo.
09:34 jmm_ ( I'm googling about parrots binding ).
09:34 tadzik probably nothing, as it's so old everything it uses is probably deprecated :)
09:34 moritz_ tadzik: modules.perl6.org is currently static HTML, generated by web/build-project-list.pl on via cronjob
09:35 moritz_ tadzik: and unless there's a very good reason, I'd like to keep it as static HTML
09:38 tadzik moritz_: where does it live, feather?
09:39 moritz_ tadzik: feather2
09:47 JimmyZ joined #perl6
09:49 JimmyZ moritz_: that's a special case :)
09:50 moritz_ JimmyZ: in what way? does the make require that variable to be set in the Makefile?
09:51 moritz_ JimmyZ: I'm not against the patch, I just try to understand why it's needed
09:51 moritz_ JimmyZ: and it needs better comments for sure
09:53 JimmyZ moritz_: without it, run make then outputs '"D:/Program Files/Git/bin/sh.exe": D:strawberryperlbinperl.exe: command not found'
09:55 JimmyZ moritz_: that is, you can't build parrot or rakudo without set shell = cmd
09:56 woosley left #perl6
09:56 moritz_ because the git installation provides its own sh.exe?
09:56 jnthn tadzik: gah, that looks...weird. I ended up having to remove an arg fromt he macro usage to make it work.
09:57 JimmyZ moritz_: I am not sure why make likes sh.exe, I think make looks for 'sh[.exe]' first,
10:02 JimmyZ moritz_: http://www.gnu.org/prep/standards/html_node/Makefile-Basics.html#Makefile-Basics, this one
10:03 mtk left #perl6
10:04 moritz_ tadzik, jnthn: I get the same error when building on a new parrot. Works fine on an old one (the one recommended in build/PARROT_REVISION)
10:05 JimmyZ moritz_: it says 'avoid trouble on systems where the SHELL variable might be inherited from the environment'
10:05 moritz_ JimmyZ: yes, that makes sense. Thanks for the link
10:05 JimmyZ moritz_: :)
10:08 am0c joined #perl6
10:09 jnthn moritz_: Oh
10:09 jnthn moritz_: OK, that explains it.
10:12 mtk joined #perl6
10:16 tzhs joined #perl6
10:23 _twitch joined #perl6
10:33 colomon phenny: tell masak http://justrakudoit.wordpress.com/2011/03/09/benchmarking-p5/ and http://justrakudoit.wordpress.com/2011/03/09/more-on-masaks-p5/
10:33 phenny colomon: I'll pass that on when masak is around.
10:35 porter235 joined #perl6
10:39 JimmyZ left #perl6
10:39 porter235 left #perl6
10:54 moritz_ colomon++ # more benchmarking
10:54 moritz_ as I mentioned beefore, I found the case of no common character at all very degenerate
10:58 Mowah left #perl6
10:59 coldhead left #perl6
11:10 Hackbinary left #perl6
11:28 kappa joined #perl6
11:30 kappa how do I flatten a list of lists in Perl 6?
11:32 moritz_ rakudo: .say for ([1, 2], [3, 4])>>.flat
11:32 p6eval rakudo 3680ac: OUTPUT«1␤2␤3␤4␤»
11:32 moritz_ kappa: like that
11:35 kappa oh. why is there the hyper >> meta token? is .flat applied to each individual inside array?
11:35 moritz_ yes
11:35 moritz_ (I don't know, maybe .flat is supposed to recurse, but currently it doesn't in rakudo)
11:37 shi joined #perl6
11:37 tadzik an lhf?
11:38 moritz_ probably
11:38 moritz_ but requires spec cehciking first
11:41 cjk101010 left #perl6
11:45 sji joined #perl6
11:45 agentzh joined #perl6
11:46 shi left #perl6
11:48 ircanetsss joined #perl6
11:48 ircanetsss hi everyone
11:49 ircanetsss i tried to build rakudo on windows using msvc
11:49 ircanetsss works fine but LWP::Simple module not work
11:50 ircanetsss it loads ok but when do get it fails
11:50 ircanetsss can you help me?
11:53 tadzik I'm afraid it's broken currently, due to some Parrot changes
11:53 tadzik can you show how it fails?
11:58 ircanetsss yeah, building again
12:07 Layla_91 joined #perl6
12:07 Layla_91 o/
12:08 jnthn o/
12:08 ircanetsss o/
12:09 tadzik o/
12:10 Layla_91 did you ever encounter this on ubuntu ? "Unable to locate tools.jar. Expected to find it in /usr/lib/jvm/java-6-openjdk/lib/tools.jar" I am trying to run ant.. going crazy with these native packages :S
12:11 jnthn :/
12:11 jnthn 'fraid not...
12:12 silent_h_ joined #perl6
12:14 kappa rakudo: for ({a=>1, b=>2},{c=>3})>>.flat.flat -> $p { say $p.key, $p.value }
12:15 p6eval rakudo 3680ac: OUTPUT«a1␤b2␤c3␤»
12:16 kappa I ended up with this to flatten a list of hashes. Two flats are ugly indeed. Are they absolutely needed in Rakudo or did I missed something?
12:30 ircanetsss left #perl6
12:31 nymacro left #perl6
12:32 jferrero joined #perl6
12:33 ircanetsss joined #perl6
12:33 ircanetsss > use v6;
12:33 ircanetsss _block78
12:33 ircanetsss > use LWP::Simple;
12:33 ircanetsss P
12:33 ircanetsss > my $html = LWP::Simple.get("http://google.com/");
12:33 ircanetsss Nominal type check failed for parameter '$resp'; expected Str but got Failure instead
12:33 ircanetsss >
12:33 ircanetsss tadzik:
12:33 ircanetsss help me plz if you can
12:33 ircanetsss maybe msvc is wrong?
12:33 ircanetsss left #perl6
12:34 nymacro joined #perl6
12:35 porter235 joined #perl6
12:37 kappa left #perl6
12:38 ircanetsss joined #perl6
12:44 porter235 left #perl6
12:47 Layla_91 left #perl6
13:00 jnthn ircanetsss: I build/develop Rakudo with MSVC - that tends to be the best bet for building on Windows.
13:00 jnthn I suspect the issue is with LWP
13:00 jnthn Can't look now though...$dayjob...
13:00 moritz_ no, rakudo's socket implementation has a regression
13:00 moritz_ which is why I asked ircanetsss to try it with a patch
13:01 moritz_ at least I think I did :(
13:01 moritz_ https://github.com/rakudo/rakudo/pull/20 these patches might help
13:03 moritz_ ah, I did, but in #parrot
13:07 am0c left #perl6
13:08 ircanetsss left #perl6
13:09 takadonet morning all
13:12 jmm_ hi.
13:12 whiteknight joined #perl6
13:17 nymacro left #perl6
13:26 MayDaniel joined #perl6
13:27 AndroUser joined #perl6
13:27 AndroUser o/
13:28 AndroUser is now known as colomon_droid
13:28 colomon_droid that's better
13:29 moritz_ colomon has turned into a droid!
13:33 colomon ooo, and this is even better.
13:33 * colomon has reclaimed his laptop, so isn't ircing from his phone.
13:37 xinming Is there any database driver for rakudo to use?
13:37 xinming Or It's still just a pure language?
13:37 moritz_ there's MiniDBI
13:37 moritz_ I think it supports sqlite, mysql and postgres
13:37 xinming moritz_: thanks, I'll check it.
13:38 ircanetsss joined #perl6
13:38 ircanetsss hi again how to use .pirs from parrot in rakudo perl 6
13:38 ircanetsss ?
13:39 ircanetsss use SDL
13:39 ircanetsss for example
13:39 moritz_ ircanetsss: you have to wrap it
13:39 moritz_ ircanetsss: for example the gamebase module wraps part of SDL
13:40 MayDaniel left #perl6
13:40 LoRe wird zeit dass mal jemand ein jperl macht :)
13:41 ircanetsss left #perl6
13:49 colomon_droid left #perl6
13:49 ircanetsss joined #perl6
13:49 ircanetsss left #perl6
13:51 youguy joined #perl6
13:53 _twitch left #perl6
13:53 youguy left #perl6
13:57 kaare_ left #perl6
14:27 dalek roast: dc78f9a | moritz++ | S32-list/minmax.t:
14:27 dalek roast: [minmax.t] :by must be passed by name, according to spec
14:27 dalek roast: review: https://github.com/perl6/roast/commit/dc78f9a77e
14:31 dalek rakudo: a38d453 | moritz++ | src/core/Any-list.pm:
14:31 dalek rakudo: fix RT #85674, signature of min() etc.
14:31 dalek rakudo: review: https://github.com/rakudo/rakudo/commit/a38d453904
14:32 kaare_ joined #perl6
14:33 alin_ joined #perl6
14:38 agentzh left #perl6
14:39 donri joined #perl6
14:40 porter235 joined #perl6
14:44 porter235 left #perl6
14:48 patspam_ joined #perl6
14:53 daxim left #perl6
14:54 Holy_Cow joined #perl6
14:54 satyavvd left #perl6
14:56 colomon rakudo: say <a c g t>.roll(100)
14:56 p6eval rakudo 3680ac: OUTPUT«accgccaaccggaaagaatgtcctcccaccacaaatgtacgctcgcatggcggttgtcgagtctatgtcggttgcgctatactacatgataatggacgcc␤»
14:56 colomon rakudo: say <a c g t>.roll(100)
14:56 p6eval rakudo 3680ac: OUTPUT«ttacttacccaaagtagaaataagctcgtctttgagaaccgtggactggtactacctatttttagtcaaactcatgactcgcgcctagcccacatacaat␤»
14:56 * moritz_ wants a .troll method
14:57 colomon would it sit under .Bridge somehow?
14:57 moritz_ I hope so :-)
14:57 moritz_ /=-~~-=\
14:58 * moritz_ not a good ASCII bridge builder
15:00 donri rakudo: for ^Inf { next unless <a c g t>.roll(7).join eq "gattaca"; say $^x; last }
15:00 daxim joined #perl6
15:00 p6eval rakudo 3680ac: OUTPUT«(timeout)»
15:00 pyrimidine heh
15:00 donri :(
15:02 moritz_ donri: go buy us a faster server :-)
15:02 pyrimidine moritz_: what is the current timeout set to?
15:02 donri yea with the money i totally have right
15:03 moritz_ pyrimidine: I don't remember
15:06 sji left #perl6
15:08 M_o_C joined #perl6
15:09 patspam_ left #perl6
15:11 pyrimidine rakudo: for ^Inf { next unless <a c g t>.roll(10).join ~~ /gattaca/; say $^x; last }
15:12 pyrimidine boom
15:12 p6eval rakudo 3680ac: OUTPUT«(timeout)»
15:12 pyrimidine rakudo: for ^Inf { next unless <a c g t>.roll(10).join ~~ /gatt/; say $^x; last }
15:12 p6eval rakudo 3680ac: OUTPUT«(timeout)»
15:13 pyrimidine locally that worked pretty fast, so the timeout must be set fairly low
15:13 M_o_C left #perl6
15:13 pyrimidine rakudo: for ^Inf { next unless <a c g t>.roll(10).join ~~ /gat/; say $^x; last }
15:13 p6eval rakudo 3680ac: OUTPUT«12␤»
15:13 moritz_ what's "pretty fast"?
15:13 takadonet 5 seconds for me
15:14 pyrimidine 1-2 secs for me
15:14 takadonet i had a bad roll :(
15:14 moritz_ I think the timeout is about 8 to 12 seconds, but the machine isn't the fastest
15:14 donri > for ^Inf { next unless <a c g t>.roll(100).join ~~ /gattaca/; say $^x; last }
15:14 donri 165
15:15 donri that took many seconds
15:15 moritz_ and sometimes the load is high when some project rebuilds
15:15 pyrimidine donri: yes, saw that too
15:16 donri Evolution: brute-force.
15:21 Alias_ joined #perl6
15:22 ymasory joined #perl6
15:22 Hackbinary joined #perl6
15:32 cjk101010 joined #perl6
15:39 wtw left #perl6
15:50 cotto joined #perl6
15:50 justatheory joined #perl6
15:51 cotto left #perl6
15:51 risou joined #perl6
15:53 cotto joined #perl6
15:54 justatheory left #perl6
15:58 tzhs left #perl6
16:06 sorear good * #perl6
16:08 tadzik hello
16:08 jmm_ hiho.
16:08 colomon \o
16:13 Patterner left #perl6
16:19 Psyche^ joined #perl6
16:19 Psyche^ is now known as Patterner
16:20 dalek specs: 56a1b09 | larry++ | S12-objects.pod:
16:20 dalek specs: dispatch generation should work under MI
16:20 dalek specs:
16:20 dalek specs: Fixed an ambiguity noted by sorear++.  It's not just the presence
16:20 dalek specs: of multi declarations in the current scope that cause autogeneration
16:20 dalek specs: of a dispatch routine.  Any difference in the candidate set at the point
16:20 dalek specs: of call should make a fresh dispatcher.  We can reuse parent dispatchers
16:20 dalek specs: only if they represent the same set of routines.
16:20 dalek specs: review: https://github.com/perl6/specs/commit/56a1b09e13
16:21 Alias left #perl6
16:24 estrabd left #perl6
16:24 sorear excellent.  TimToady++
16:25 MayDaniel joined #perl6
16:26 estrabd joined #perl6
16:33 wamba joined #perl6
16:40 porter235 joined #perl6
16:41 cjk101010 left #perl6
16:44 dalek niecza: b3b0f37 | sorear++ | / (5 files):
16:44 dalek niecza: Implement user-specified parameter types
16:44 dalek niecza: review: https://github.com/sorear/niecza/commit/b3b0f37f7f
16:44 donri left #perl6
16:45 porter235 left #perl6
16:48 wamba left #perl6
17:05 sorear after updating to a March 8 build of Mono and fudging a few things, I can build against the 2.0 profile again \o/
17:06 dsp_ left #perl6
17:06 pyrimidine sorear++
17:07 takadonet sorear: how does it look?
17:08 sorear takadonet: how does it look?  entirely possible 2.6 compatibility will be restored today.
17:08 sorear (someone in the mono project)++ # the bug was closed "cannot reproduce in master" and I'm too lazy to bisect
17:09 takadonet sorear: if you do, give me a shout so I can build it :)
17:11 dsp_ joined #perl6
17:12 alin__ joined #perl6
17:13 alin__ left #perl6
17:15 jnthn evenin'
17:16 jnthn Ah, nice clarification in the multi spec. Pretty sure that's what I already implemented it as anyway, though. :)
17:17 alin_ left #perl6
17:18 sorear hello jnthn
17:18 sorear perfect timing as always; I need to leave in five
17:19 sorear bleh, current niecza doesn't want to compile itself
17:19 donri joined #perl6
17:20 sorear hello donri
17:20 donri hello there
17:20 jnthn sorear: o/
17:21 jnthn sorear: Heh...blame social conventions around $dayjob attendance times. :)
17:29 gdey_ joined #perl6
17:38 hudnix left #perl6
17:40 justatheory joined #perl6
17:42 dsp_ left #perl6
17:44 jaldhar left #perl6
17:45 jaldhar joined #perl6
17:45 daxim left #perl6
17:45 shi joined #perl6
17:45 icwiener joined #perl6
17:49 jaldhar left #perl6
17:50 jaldhar joined #perl6
17:51 mtk left #perl6
17:51 justatheory left #perl6
17:51 justatheory joined #perl6
17:51 justatheory left #perl6
17:53 rokoteko left #perl6
17:53 rokoteko joined #perl6
17:54 plobsing left #perl6
17:54 dsp_ joined #perl6
17:59 cdarroch joined #perl6
17:59 cdarroch left #perl6
17:59 cdarroch joined #perl6
17:59 fhelmberger left #perl6
17:59 jaldhar left #perl6
17:59 mtk joined #perl6
17:59 gdey_ left #perl6
18:01 gdey_ joined #perl6
18:02 silent_h_ left #perl6
18:06 ab5tract joined #perl6
18:10 stephenlb joined #perl6
18:10 dakkar left #perl6
18:11 plobsing joined #perl6
18:12 mtk left #perl6
18:14 mtk joined #perl6
18:16 ashleydev left #perl6
18:21 ashleydev joined #perl6
18:21 mtk left #perl6
18:23 mtk joined #perl6
18:24 Holy_Cow left #perl6
18:25 Holy_Cow joined #perl6
18:26 mtk left #perl6
18:30 stephenlb Wall is breifly mentioned in a heroes song: http://www.pubnub.com/blog/internet-heroes-song-crockford-dahl-wall-torvalds-resig-souders
18:31 stephenlb s/breifly/briefly
18:31 mberends joined #perl6
18:31 mtk joined #perl6
18:32 Eevee left #perl6
18:33 Eevee joined #perl6
18:33 ymasory left #perl6
18:36 colomon So, at what point do I give up on benchmarking a p5 run?  A pair of strings that takes 167 seconds in one of the p5 scripts has now been running for over an hour in another....
18:39 masak joined #perl6
18:39 masak gd'eve, zebras.
18:39 phenny masak: 10:33Z <colomon> tell masak http://justrakudoit.wordpress.com/2011/03/09/benchmarking-p5/ and http://justrakudoit.wordpress.com/2011/03/09/more-on-masaks-p5/
18:39 colomon \o
18:39 masak colomon: \o/
18:40 masak I saw the first one earlier today. will read the second now.
18:41 colomon I kind of hope someone else tries running a few, because right now it's looking like a very self-serving benchmarking.  ;)
18:41 porter235 joined #perl6
18:41 masak I don't mind that one jot.
18:41 jnthn o/ masak!
18:41 masak moritz_: you also seem to be serving moritz_ and... fox!
18:42 masak jnthn: \o!
18:42 tadzik yayitsmasak!
18:44 colomon masak: oooo, good point.  I just noticed moritz_ beat me out on my new, longer DNA test.
18:44 ymasory joined #perl6
18:44 colomon (not posted yet)
18:44 jevin joined #perl6
18:45 masak amd all my old rationales just go out the window... :P
18:45 colomon dna-2, p5-colomon.pl, 16.0393736, 15.921665, 16.17857
18:45 colomon dna-2, p5-fox.pl, 19.6781661, 19.585883, 19.813437
18:45 colomon dna-2, p5-matthias.pl, 175.119308, 173.464796, 177.424137
18:45 colomon dna-2, p5-moritz.pl, 15.4255487, 15.365786, 15.51322
18:45 colomon dna-2, p5-util.pl, 49.9942837, 49.677288, 50.362169
18:45 masak moritz_++
18:45 masak colomon++
18:45 masak fox++
18:45 porter235 left #perl6
18:46 gdey_ left #perl6
18:46 Juerd At the Dutch Perl Workshop I heard that contexts are gone. What's a good place to read about the decision and its consequences?
18:46 masak Juerd: I think moritz_ once wrote a nice post about it.
18:46 masak but I might be hallucinating that.
18:47 masak the gist of it all, though, is that (amount) contexts don't mesh with signature MMD.
18:48 jnthn I know the moritz_ post you're referring to. It certainly exists and is very worth a read.
18:48 tadzik rakudo: for 1..5 { NEXT if $_ ~~3; say $_ } # what's wrong?
18:48 p6eval rakudo a38d45: OUTPUT«1␤2␤Could not find sub &NEXT␤  in <anon> at line 22:/tmp/wwejO4Xu6S␤  in main program body at line 1␤»
18:50 colomon NEXT?
18:50 tadzik em, the phaser, right? Like continue; in C
18:50 colomon rakudo: for 1..5 { next if $_ ~~3; say $_ } # what's wrong?
18:50 p6eval rakudo a38d45: OUTPUT«1␤2␤4␤5␤»
18:51 colomon not a phaser.
18:51 colomon unless there's also a phaser I don't know about there.  (very possible)
18:51 tadzik ok, thanks
18:52 Juerd moritz_: Where can I find your writeup on the removal of Contexts?
18:53 jnthn Juerd: Ah, here it is: http://perlgeek.de/blog-en/perl-6/immutable-sigils-and-context.html
18:53 Juerd Thanks a lot
18:53 Juerd In 2009 already? Oh my, I really haven't been paying attention!
18:54 Juerd jnthn: That post does assume context still exists
18:55 jnthn jnthn: Not in the inwards-flowing sense though.
18:55 Juerd But in a different way, with an object.
18:55 Juerd Right, so it doesn't propagate but essentially the functionality is still there
18:55 justatheory joined #perl6
18:55 masak <Juerd> In 2009 already? Oh my, I really haven't been paying attention!
18:56 masak Juerd: so the "while you blinked" wasn't too out of place, then :P
18:56 Juerd I'm not sure this could still count as blinking :)
18:57 tadzik masak: mind a question about Pls?
18:57 masak Juerd: anyway, welcome back. enjoy the lack of contexts. :)
18:57 masak tadzik: sure. fire away.
18:57 Juerd I'm not "back" in any sense
18:59 tadzik masak: in Pls, there is a standard, predefined method running fetch, build, test, install. What if you want to omit testing phase, as in --notest of --force? Overloading the entire method breaks the sense of Pls
18:59 masak yes.
18:59 masak likely the predefined method is too simplistic.
19:00 masak and needs to be extended.
19:00 masak it's not in Pls::Core, is it?
19:00 tadzik I think it is, lemee see
19:01 tadzik oh, there is !fetch-helper, !build-helper etc, so I think the idea is that an implementation will be able to just overload one of those?
19:01 gdey_ joined #perl6
19:02 masak that's not something that I intended, no.
19:03 masak let's take a step back for a while. I don't think I understand your use case.
19:03 masak do you want to do something that the tests don't already do?
19:03 tadzik what tests?
19:03 tadzik I want my implementation to omit tests, under some circumstances
19:03 masak pls's tests.
19:04 masak 'pls test <module>' should do what you want.
19:05 tadzik hrm, I don't think you understand my use case :)
19:05 tadzik or another way: what if you want to skip resolving dependencies?
19:07 masak oh!
19:07 masak I think that's a use case Pls simply does not implement.
19:07 masak it's very keen on dependencies.
19:08 masak it can install things without the tests passing, but it can't test things without the dependencies being installed.
19:08 tadzik the workaround would be to overload a dependencies() method in Pls::Project, but that's rather ugly
19:08 masak guess I didn't think there'd be anyone wanting that.
19:09 masak I mean, it's a module installer, not a development framework.
19:09 tadzik yeah, but even cpanminus has --nodeps or something
19:09 masak oh, ok.
19:09 masak as I said, it can probably be added in pls itself rather than extending it from the outside.
19:10 masak similar to --force and --notest
19:10 tadzik which are inside?
19:10 tadzik aye, I see
19:15 plobsing left #perl6
19:20 mberends colomon: ahem, comparing p5-colomon.pl to a (slower) unpuplished one of my own, yours failed to find the longest common substring. Using the third data set from http://justrakudoit.wordpress.com/2011/03/09/more-on-masaks-p5/, yours found ' were' and it should have found ' other' :/
19:21 mberends and yes, I'll publish mine soon ;)
19:22 colomon mberends:
19:22 colomon mberends: yes, been wondering about correctness in all the codes, too.
19:23 mberends it may be just a minor detail in your port
19:23 colomon actually, though, I think you're wrong in this case
19:23 colomon it's " were ", not " were".
19:23 colomon or at least, it should be
19:23 mberends ah, ok :)
19:24 colomon give me a sec to look closer
19:24 mberends add quotes to the output, and also print the .chars result
19:25 colomon oooo, hey, p5-matthias.pl actually completed the first trial run on my "super-long" Dumas text comparison
19:25 colomon of course, it will be until tomorrow until the entire thing is done at this rate.  :)
19:27 mberends p5-mberends.pl ex-contest, and not a speed record either http://pastebin.com/rK4tz0UE
19:27 mberends colomon: please try mine on a few texts and give me your impressions
19:29 plobsing joined #perl6
19:29 colomon mberends: I'll give it a try, but as I say, the benchmarking is very tied up with a slow routine at the moment.  :)
19:30 colomon mberends: my code finds both * were * and * other*, and since they're tied in length either one is a valid answer.
19:30 colomon afk
19:32 [particle] left #perl6
19:33 gdey_ left #perl6
19:33 gdey_ joined #perl6
19:35 Util Blizkost requires Perl 5.10 to Configure, saying:
19:35 Util "Ideally we'd support back further, but fixing the macro framework back in time is not a priority"
19:35 Util Darwin 10.5 uses Perl 5.8, so I can't make Blizkost part of the binary .dmg.
19:35 Util What will it take to resolve this?
19:36 dalek ecosystem: a0d4d4a | tadzik++ | projects.list:
19:36 dalek ecosystem: Add 2 new modules of mine
19:36 dalek ecosystem: review: https://github.com/perl6/ecosystem/commit/a0d4d4a388
19:36 mberends Util: any idea what macro(s) the comment is referring to?
19:37 Util No; I have not poked that deep into it, hoping that someone in the channel already knew.
19:38 Util afk for 20 minutes
19:39 ymasory left #perl6
19:41 impious joined #perl6
19:42 colomon mberends: ooo, interesting approach!
19:43 mberends really an electronic engineer's approach
19:44 mberends your could build it with far fewer nand gates than the other solutions ;)
19:48 marietta joined #perl6
19:48 impious left #perl6
19:48 ab5tract left #perl6
19:49 [particle] joined #perl6
19:52 ymasory joined #perl6
19:54 jeteve_ joined #perl6
19:56 jjore_ left #perl6
19:58 masak mberends++
19:59 masak mberends: fwiw, I've had the same feeling about .chars at times. it's a slightly unfortunate name.
20:00 jjore joined #perl6
20:00 fisted_ is now known as fisted
20:01 mberends masak: I also made the mistake of optimistically expecting p5-mberends.pl to be faster than it turned out to be. At least I only told you verbally :/
20:02 masak p5 speed seems highly non-intuitive.
20:03 mberends would you be interested in a naive C translation?
20:04 masak hm... I'm not going to actually need a LSC algorithm anytime soon. and this is a Perl 6 contest... :P
20:04 masak LCS*
20:06 ymasory left #perl6
20:12 Util back
20:13 masak Util: \o
20:18 petdance joined #perl6
20:22 flussence rakudo: 'abcde' ~~ m:ex/../ # nyi?
20:22 p6eval rakudo a38d45: OUTPUT«===SORRY!===␤Adverb 'ex' not allowed on m at line 22, near " # nyi?"␤»
20:22 jnthn std: 'abcde' ~~ m:ex/../
20:22 p6eval std 4608239: OUTPUT«ok 00:01 122m␤»
20:22 jnthn NYI I expect.
20:24 * masak thought :ex was killed off
20:24 flussence S05:504 - still there
20:24 masak hm, maybe that was some other regex adverb, then.
20:29 Util jnthn: Please see my earlier Blitkost Q: http://irclog.perlgeek.de/perl6/2011-03-09#i_3376521
20:29 jnthn Util: I saw it, but don't know the answer. sorear++ probably does.
20:30 Util thanks
20:33 ymasory joined #perl6
20:34 [Coke] Util: you could include a copy of perl 5.12.x in the dmg.
20:37 Util left #perl6
20:37 Util joined #perl6
20:42 Su-Shee left #perl6
20:42 porter235 joined #perl6
20:47 porter235 left #perl6
20:49 justatheory left #perl6
20:51 petdance left #perl6
20:56 MayDaniel left #perl6
20:57 Rotwang joined #perl6
21:02 SalmanAbbas007 joined #perl6
21:02 SalmanAbbas007 left #perl6
21:09 gdey- joined #perl6
21:13 gdey_ left #perl6
21:16 coldhead joined #perl6
21:16 gdey_ joined #perl6
21:21 gdey- left #perl6
21:24 masak 'night, #perl6
21:25 masak left #perl6
21:26 justatheory joined #perl6
21:34 y3llow_ joined #perl6
21:35 y3llow left #perl6
21:35 y3llow_ is now known as y3llow
21:41 starcoder left #perl6
21:43 imamelia joined #perl6
21:44 cognominal left #perl6
21:49 starcoder joined #perl6
21:50 petdance joined #perl6
21:51 takadonet rakudo: my $ya = "<[AGTC]>"; my $x= rx/$ya/; if 'A' ~~ $x { say 'boo' }
21:51 p6eval rakudo a38d45:  ( no output )
21:51 takadonet any takers?
21:51 imamelia left #perl6
21:52 jnthn rakudo: my $ya = "<[AGTC]>"; my $x= rx/<$ya>/; if 'A' ~~ $x { say 'boo' }
21:52 p6eval rakudo a38d45: OUTPUT«boo␤»
21:52 takadonet !!!!!!!!!!!1
21:52 jnthn $ya = interpolate as literal, <$ya> = interpolate as regex syntax.
21:52 sjohnson heh
21:52 kaare_ left #perl6
21:52 jnthn They're (happily) distinct operations in Perl 6. :)
21:53 jnthn Which means it's harder to get vulnerable to a regex injection exploit. :)
21:53 huf also different things look different ;)
21:53 huf \o/
21:53 jnthn Right :)
21:53 takadonet Had a hard time finding that rule in syn....
21:53 takadonet n/m
21:53 takadonet i just found it
21:53 takadonet hehe
21:55 justatheory left #perl6
21:55 stkowski joined #perl6
21:57 mberends left #perl6
21:57 justatheory joined #perl6
21:58 [Coke] left #perl6
21:59 shi left #perl6
21:59 __rnddim__ joined #perl6
21:59 cognominal joined #perl6
21:59 [Coke] joined #perl6
22:03 lue left #perl6
22:04 ymasory left #perl6
22:09 Holy_Cow left #perl6
22:13 gdey_ left #perl6
22:14 gdey_ joined #perl6
22:14 [particle]1 joined #perl6
22:16 [particle] left #perl6
22:25 justatheory left #perl6
22:31 sftp left #perl6
22:36 TheMartianGeek joined #perl6
22:39 jferrero left #perl6
22:40 sftp joined #perl6
22:40 jferrero joined #perl6
22:43 porter235 joined #perl6
22:48 porter235 left #perl6
22:49 petdance left #perl6
22:53 noganex left #perl6
22:59 ymasory joined #perl6
23:10 noganex joined #perl6
23:11 cosimo joined #perl6
23:14 marietta left #perl6
23:22 justatheory joined #perl6
23:22 jeteve_ left #perl6
23:28 sorear good * #perl6
23:28 risou left #perl6
23:30 sorear Util: I am thorougly disgusted by blizkost's current design and have blanked all details of it from my memory.
23:31 petdance joined #perl6
23:33 jnthn .oO( The disgusting parts are probably the bits left over from when I hacked on it... )
23:34 diakopter sorear: you've been enlightened since your time working on it, or...?
23:34 TheMartianGeek Speaking of bad design, PerlMonks.  I don't know what is up with their forum design, but it's awkward both to use and aesthetically.
23:38 sorear fun fact: perlmonks is a fork of everything2.com
23:38 sorear hmm
23:39 sorear I am starting to reply to pmichaud.  However, my reply would make more sense on p6l than p6c.
23:39 sorear Should I break the thread?
23:39 sorear Should I send it to p6l, p6c, or both? (independant of above)
23:40 sorear diakopter: trying to improve blizkost put me against increasing resistance; I gave up in the middle of trying to allow access to Perl 5 hashes
23:41 sorear diakopter: if I were to start a blizkost-like project today, I would use fork() and some kind of remoting stuff.  Trying to link libperl.so is not work it
23:41 sorear worth
23:42 patch_ joined #perl6
23:46 Rotwang left #perl6
23:54 Util sorear: thanks. Sounds like the right thing to do for now is continue to omit Blizkost from the R* binary.
23:55 fisted_ joined #perl6
23:57 fisted left #perl6

| Channels | #perl6 index | Today | | Search | Google Search | Plain-Text | summary

Perl 6 | Reference Documentation | Rakudo