Perl 6 - the future is here, just unevenly distributed

IRC log for #thegeekgroup, 2012-05-27

| Channels | #thegeekgroup index | Today | | Search | Google Search | Plain-Text | summary

All times shown according to UTC.

Time Nick Message
00:16 * Yrouel 'night
00:32 Carvagon quiet evening in here
00:39 coleco Anybody that lives in GR, you wanna draft?
00:39 coleco Draft some magik
00:49 guardianzozo joined #thegeekgroup
00:51 wannabe1987 joined #thegeekgroup
00:52 wannabe1987 look!  its the dr!  carrying a torch!
00:57 switch joined #thegeekgroup
00:57 switch hiya
00:58 wannabe1987 hi
00:58 switch how are you wannabe1987
00:59 wannabe1987 exhausted.  i tore apart computers at the lab for 4+ hours
00:59 switch oh rly? who are you in the videos
01:01 switch excuse my ignorance i dont know many peoples forum or chat names
01:04 wannabe1987 kelly
01:04 wannabe1987 not in most vids
01:05 switch i think i might have seen you
01:05 Administrator_ joined #thegeekgroup
01:05 switch were you the on with the trading card things at ventines day and wanted to see mcphee with his shirt off
01:05 wannabe1987 no thats lisa
01:06 switch then my minds a blank hwayello any
01:06 switch then my minds a blank hello anyway*
01:06 wannabe1987 like i said, i'm there almost daily but not in most vids....i don't like being in vids....
01:06 wannabe1987 but hello nonetheless
01:07 switch id say id love to work on computers all day at tgg but i guess theres a diference between doing something i love and being told to do something related to what i love
01:08 wannabe1987 mhm
01:08 switch have you had the joy of playing with win 8 yet
01:08 Hydroelectric joined #thegeekgroup
01:10 switch i thought it would be a smart idea to install it on my laptop to try out to see if it was worth while putting it on my new pc build but its just so horrible its like using a giant phone
01:16 BotSteve wannabe1987: cartown
01:19 wannabe1987 nope
01:19 wannabe1987 idk if we even have win 8 at the lab....
01:20 wannabe1987 sorry, busy making supper
01:28 Monkeh|Lap Pretty sure you do.
01:28 Monkeh|Lap Unfortunately.
01:29 wannabe1987 yeah...i think i've seen one disc of it
01:40 Si235 joined #thegeekgroup
01:42 wannabe-afk joined #thegeekgroup
01:45 wannabe-afk fyi cybermen are taking over
01:45 wannabe-afk humans are being upgraded
01:48 Damianz Are dogs too?
01:48 wannabe1987 i don't see any....
01:51 tehdark45 joined #thegeekgroup
01:57 ageha joined #thegeekgroup
01:57 Carvagon joined #thegeekgroup
01:58 switch i might run osx86 on my new pc
02:03 Carvagon good evening everybody
02:11 wannabe1987 hi
02:18 Carvagon anybody have a good youtube downloader?
02:19 HighMan Addon- Video Helper
02:19 Damianz youtube-dl
02:20 HighMan Only for FF so... lol
02:21 tehmobile45 joined #thegeekgroup
02:21 Carvagon lol i dont care what its for.  gotta be better than the one i have.  thanks!
02:22 HighMan xD
02:22 tehmobile45 Hyyyyyy
02:22 HighMan Yah? lol
02:23 tehmobile45 Lolz
02:23 HighMan ?
02:23 tehmobile45 Watch out for hy Carvagon
02:23 HighMan I used to ride in a caravan ;)
02:24 HighMan Dodge Grand Caravan 1997
02:24 Carvagon car + van + wagon = carvagon lol
02:24 HighMan XD
02:24 dh8dl Carvagon this one works for me: http://www.youtubedownloadersite.com/
02:24 BotSteve Title: YouTube Converter & Free Downloader: Convert YouTube Videos (YTD)
02:25 tehmobile45 Ha i rode in a 98 plymoth voyager espresso
02:25 Carvagon yeah thats what i used to have but AVG keeps flagging every dl
02:25 dh8dl weird
02:25 HighMan 1. AVG can die in a fire.
02:25 exor674 stop downloading shady stuff :P
02:25 tehmobile45 Avg is shit now
02:25 HighMan 2. Go remove it and then install AVAST
02:25 tehmobile45 No hy
02:25 HighMan Or buy Kaspersky Internet or Eset Internet
02:25 dh8dl no problem for me with avast free antivirus
02:25 tehmobile45 Mse is what you want
02:26 HighMan Screw them :P
02:26 HighMan Avast is much better
02:26 dh8dl yep
02:26 tehmobile45 Mse is m$ so it must be good
02:26 HighMan tehmobile45, Why don't you use mcafee xD
02:27 Carvagon lol yeah i couldnt pass up a full license of AVG for free until 2018
02:27 tehmobile45 My dad uses norton -_-
02:27 Carvagon thats what i get
02:27 injektion joined #thegeekgroup
02:27 HighMan Norton sucks lol, my friend wants to argue with me against that but what ever lol
02:27 HighMan Carvagon, Avast is free...
02:27 tehmobile45 Hy, avg free is you dolt
02:27 HighMan I hate avg
02:28 tehmobile45 No, it hates you
02:28 HighMan :P
02:28 injektion I use MSE
02:28 HighMan Avast + Mbam + Spy Bot
02:28 Carvagon i like AVG except for its constant tendency to flag .exe and .dll files
02:28 tehmobile45 Injektion, virus bros
02:28 injektion I used to use symantec endpoint
02:28 tehmobile45 Lol symantic
02:28 Carvagon AVG + Malwarbytes + Registry Mechanic
02:29 HighMan Registry Mechanic? Hahahahaha
02:29 HighMan And also CCleaner
02:29 HighMan with enhancer
02:29 injektion tehmobile45, version 12 isn't too bad but it's still a resource hog
02:31 tehmobile45 Yep
02:31 Carvagon registry mechanic works like a champ for me
02:32 injektion I always re-image when I get registry errors
02:32 HighMan I thought anything registry cleaning was bad
02:32 dh8dl i also like TuneUp Utilities
02:32 Carvagon it doesnt clean it.  it finds the changes and errors and reverts to previous working versions
02:32 Carvagon or settings
02:32 tehmobile45 And deletes orphans
02:32 HighMan I always heard that if you mess with registry it might delete things that will corrupt applications
02:32 HighMan or make it unable to uninstall
02:33 injektion MS needs to get rid of the registry
02:33 HighMan or screw up services and other compnents
02:33 tehmobile45 Highman, backup
02:33 Carvagon never had a problem with it.  had it for 5+ years
02:33 HighMan tehmobile45, What's a backup :P
02:33 HighMan "You aren't using it right till you break it" lol
02:33 tehmobile45 Its your mom
02:33 HighMan I don't do backups lawl
02:33 injektion INI files were great the registry not so much
02:34 Carvagon do u guys open alot of PDF's?  nifty little trick i learned from an Adobe rep to clean some stuff up
02:34 HighMan ...
02:35 dh8dl there are reasons why a registry is better than seperate ini files
02:35 Carvagon Start; Run; CMD; CD; del acr *.tmp /s;
02:35 HighMan I leave the registry be lol, I don't even tuch it.
02:36 dh8dl cause different programs running on your pc can find informations easier that way..for example with programs that work together in one way or the other
02:36 dh8dl like media players that need to find the right codecs to play something for example
02:36 injektion *NIX gets along just fine without one
02:37 dh8dl if they got to scan the whole pc first to find it then you could go drink a coffee until it finds them
02:37 dh8dl don't know, i'm just a windows user
02:37 * dh8dl ducks
02:38 HighMan I am to lol
02:38 HighMan *too
02:38 * HighMan Chucks
02:38 wannabe1987 nothing wrong with windows
02:38 HighMan Hi wannabe1987
02:38 wannabe1987 hi hi
02:38 HighMan :P How's your day?
02:38 wannabe1987 exhausting
02:39 dh8dl the only time i used linux was on my satellite receiver (with a modded os based on linux) and a self made router for my pc's
02:39 HighMan xD
02:39 HighMan I've used linux for G-Parted, recovery, and if DD-WRT is linux based then that.
02:39 wannabe1987 i scrapped computers from 1:45ish to 8or so
02:39 exor674 linux routers = \o/
02:39 HighMan Damn...
02:40 injektion I have Linux running in 2 places: VMware EXSi, Apache VM
02:40 injektion My router runs FreeBSD
02:40 dh8dl mine ran Fli4L
02:40 HighMan I'm X-Booting, Osx Lion, Ubuntu, Windows 7, Windows 8, Windows xP
02:42 injektion I prefer EXSi over XenServer
02:44 HighMan I see there are a few new IRC'rs since I've been on
02:49 HighMan Any new additions on the bot?
03:03 HighMan Night All!
03:03 HighMan BitViper, I is gonna use Spin Rite
03:14 SparkyProjects left #thegeekgroup
03:19 Carvagon joined #thegeekgroup
03:20 Carvagon if u like japanese gameshows: http://gakifiles.blogspot.com/p/watch-clips.html
03:20 BotSteve Title: Gaki No Tsukai with English Subtitles: Watch Videos
03:28 eadthem joined #thegeekgroup
03:55 * wannabe1987 found some firefly to watch.....
03:57 * Thermoelectric has found another assignment that wants to get done.
03:57 wannabe1987 how fun! :P
03:57 Thermoelectric Very much so. Wanna swap? :P
03:57 wannabe1987 what class?
03:58 Thermoelectric This one is for physics
03:58 wannabe1987 if you wanna fail, go right ahead....otherwise i'll stay comfy in my bed
03:58 Thermoelectric Pfft, ah well, I'll continue to waste my weekend on these assignments. :(
03:59 wannabe1987 i never took physics....
03:59 Thermoelectric Slacker.
03:59 wannabe1987 it confuses me
03:59 wannabe1987 (i was never required to take it either)
04:05 KB3NZQ joined #thegeekgroup
04:15 ajprog_laptop wannabe1987: hi
04:15 wannabe1987 hi jeff
04:16 ajprog_laptop is zozo around to get a quick opinion from?
04:16 wannabe1987 nope.  he passed out an hour ago
04:16 wannabe1987 we had a tough day at the lab....he was dealing with security/network, i was scrapping/parting out computers
04:16 ajprog_laptop it is only 12:15 he is becoming a light weight ;)
04:17 wannabe1987 i know, i was suprised.
04:17 wannabe1987 but this means i can take control of the "tv" and watch firefly :D
04:17 ajprog_laptop I will pm him, if he can look sometime today
04:18 wannabe1987 ok.
04:18 ajprog_laptop he doesn't need to research, just his first opinion
04:18 wannabe1987 kk i'll let him know
04:21 tehmobile45 joined #thegeekgroup
04:22 wannabe1987 when do they pick up river tam?
04:22 wannabe1987 and why do dr who and firefly have someone with the first name river?  (River song, river tam)?
04:26 tehmobile45 Fun?
04:29 wannabe1987 StopMakingSense!
04:29 wannabe1987 btw, who *are* you?
04:32 StopMakingSense i usually go by FearOfMusic or LittleCreature
04:32 wannabe1987 yes.  i know....
04:33 wannabe1987 but you don't talk much.....where are you from?
04:33 StopMakingSense michigan
04:33 wannabe1987 where in this wonderful state?
04:33 StopMakingSense kalamazoo
04:33 tehmobile45 Wannabe, about 10% of us talk regularly lol
04:33 wannabe1987 ah.   i'm sorry.  kpoo is .... interesting.  i lived there for a summer
04:33 wannabe1987 tehmobile45, shush
04:34 wannabe1987 usually i knoww here people are from....but not this person....
04:34 wannabe1987 guy? gal?
04:34 StopMakingSense me?
04:34 tehmobile45 Eww not kzoo. Even the name sounds bad lol
04:34 StopMakingSense :(
04:35 StopMakingSense i think kalamazoo is a nice place
04:35 tehmobile45 Ok well dont run a 501c3 threre
04:35 StopMakingSense except the really good bakery burned down
04:35 wannabe1987 its a nice place...i lived westish of kzoo, off drake road
04:35 tehmobile45 There*
04:36 wannabe1987 the complex was great....nice pool, etc
04:37 StopMakingSense who are you?
04:38 tehmobile45 Who?
04:38 wannabe1987 me?  i'm kelly/wannabe.  i'm in a few vids
04:39 StopMakingSense were you born in 1987?
04:39 wannabe1987 yep!
04:40 tehmobile45 I was not born in 45 :P
04:40 tehdark45 joined #thegeekgroup
04:41 StopMakingSense i was born in 1987 as well
04:42 tehdark45 so how many computers did you scrap wannabe1987
04:42 wannabe1987 :shrug:  around 15
04:43 wannabe1987 i stopped counting after 9
04:43 tehdark45 lol
04:44 tehdark45 so i guess you have gone to the lab StopMakingSense?
04:44 StopMakingSense no
04:44 tehdark45 O_o
04:44 wannabe1987 did you go when it was in kzoo?
04:44 wannabe1987 .seen Cprossu
04:44 BotSteve wannabe1987: I last saw Cprossu 44.04 hours ago at 2012-05-25 08:42:35 UTC on #thegeekgroup.  Current time: 04:44:47 UTC
04:45 wannabe1987 thats about the last time i saw cprossu too....wtf man
04:45 StopMakingSense i didnt live in kalamazoo when it was here, i dont believe
04:45 wannabe1987 it moved out year and a half ago
04:45 StopMakingSense thats is probably just when i moved here
04:45 wannabe1987 ahhh.  where'd you move from?  whatcha doin there and how'd you find us?
04:46 * wannabe1987 plays 20 questions
04:46 StopMakingSense i used to live in houghton, mi
04:46 wannabe1987 o.O
04:46 wannabe1987 thats a long trip!
04:47 wannabe1987 did you go to school up there?
04:47 StopMakingSense i think i found this from a random youtube video about oscilloscopes or something
04:47 StopMakingSense for a while, yes
04:47 wannabe1987 youtube is the best way to find us.
04:47 tehdark45 so why havent you visited?
04:47 tehdark45 being so close
04:49 StopMakingSense i guess i dont get out much
04:49 wannabe1987 its ok.
04:49 tehdark45 you could not get out much together lol
04:49 wannabe1987 are you a guy or a gal?
04:50 StopMakingSense im a guy
04:50 wannabe1987 typical
04:50 wannabe1987 did you go to MTU?
04:50 wannabe1987 thats where my friend goes
04:50 StopMakingSense yes, i went there for some time
04:51 wannabe1987 cool
04:54 tonsofpcs hi
04:54 wannabe1987 hi tons!
04:55 tonsofpcs howdy
04:55 wannabe1987 how are you?
04:55 tonsofpcs tired... spent the morning/early afternoon helping someone move and afternoon/evening playing disc golf (with an hour+ ride to/from)
04:56 wannabe1987 oh my.  you did more physical activity than i did...i scrapped computers
04:56 tonsofpcs and then I came back to find something fun that I'd rather not disclose in a public forum
04:56 wannabe1987 :/
04:56 tonsofpcs I think it was last week that I was tossing CRTs into dumpsters
04:56 StopMakingSense what kind of computers?
04:56 tonsofpcs :D
04:56 wannabe1987 your house is still standing, right?
04:56 wannabe1987 desktops
04:56 tonsofpcs yes.
04:57 wannabe1987 took out ram, processors, etc and put all (scrap) metal in one  gaylord, plastic in another...and usable parts in the compu lab
05:00 StopMakingSense i used to have a plethora of computers... now i only have 3
05:00 tonsofpcs we've got a scrap place that deals with PCs as-is, although they'd probably pay better if we did that...
05:00 wannabe1987 i have a netbook and a laptop...
05:00 wannabe1987 i'd take a desktop if i had a desk.....
05:00 tehdark45 make one?
05:00 tonsofpcs stack a bunch of them to make one? :)
05:00 wannabe1987 i also have nowhere to put one.....
05:00 wannabe1987 LOL
05:00 tehdark45 how big is the apt?
05:01 wannabe1987 and once zozo's desktop gets here, really, it'll use up enough electricity.....
05:01 wannabe1987 2 bedroom, with living room, kitchen, and bathroom.
05:01 wannabe1987 back porch has laundry facilities
05:01 tonsofpcs i mean, a desktop is about the surface area you need for a monitor, keyboard, and mouse
05:01 tehdark45 washing outside?
05:01 tonsofpcs you just have to raise it to a workable height
05:01 wannabe1987 true
05:01 wannabe1987 no, its a closed porch
05:01 tehdark45 ohh
05:02 wannabe1987 the people upstairs use it too, so having it inside my apt would be *awkward*
05:02 tehdark45 yeah
05:02 tehdark45 just abit
05:02 wannabe1987 and i got an electric bill for about 15 days and it says no electricity was used....i'm slightly confused
05:02 StopMakingSense thats a good idea... take a bunch of desktop computers and arrange them into a big solid desk... then wire them up as a beowulf :P
05:02 tehdark45 but happy?
05:03 StopMakingSense it would just likely get very hot
05:03 tonsofpcs StopMakingSense: I wouldn't do the latter, $$$
05:03 tehdark45 well wannabe1987 all you run atm is chargers and lights
05:03 tehdark45 so not alot used
05:03 tehdark45 and hot water
05:03 wannabe1987 and a nini fridge, washer
05:03 wannabe1987 the water is heated with gas, i think
05:03 wannabe1987 mini*
05:03 tehdark45 most likely
05:04 wannabe1987 yes, but theres a server running...
05:04 tonsofpcs wannabe1987: if it says none, one of two things could be happening: (1) [you're hoping for this one] they bill estimated then read and you over-paid enough that you've paid past what the meter runs (2) [you hope it isn't this] the meter is broken
05:04 wannabe1987 theres a person reading meters....and i didn't pay last month....we just moved here
05:04 tonsofpcs oh, maybe the bill was for the time before you moved in
05:05 tehdark45 are you splitting the cost of the washer with upstairs?
05:05 wannabe1987 :shrug:
05:05 tonsofpcs if you look at the bill closely, it should say the meter reading value, you can walk outside and see how much it has changed
05:05 tonsofpcs (or wherever the meter is)
05:06 wannabe1987 fuck if i know
05:06 tehdark45 zozo can do it
05:06 wannabe1987 i know cpro fixed the damn washer as it was broke, but when he leaves we'll be fuxxored
05:06 tonsofpcs it's a metal box with a giant plastic (or glass) bubble sticking out, the display is inside the bubble
05:06 wannabe1987 yeah....but so is the gas meter
05:06 tonsofpcs newer ones have digital number readouts older ones have a bunch of needles on numbers and a spinning disc
05:07 tonsofpcs are gas and electric the same company?
05:07 wannabe1987 no
05:07 wannabe1987 i've watched my parents meter before....confused as hell :P
05:08 tonsofpcs then you can tell the difference by looking at the 'lock' tab thingy they put on it.  (usually a little colored tag that goes through the lock hole), it'll be tagged with the company name.
05:09 tehdark45 tonsofpcs, i dont think wannabe1987 is too bothered on the company
05:09 tehdark45 :P
05:09 tehdark45 with*
05:10 wannabe1987 yeah....i'll pay the 3.55 and they can be happy
05:11 wannabe1987 i'm okay with small bills...i can't afford anything else anyway...
05:11 tehdark45 run extention cord from lab to apartment
05:12 tehdark45 less bills
05:12 wannabe1987 cant  bury it under roads....
05:12 tehdark45 who said bury?
05:12 wannabe1987 ...
05:12 wannabe1987 no
05:13 * tonsofpcs is about to sugar-crash.... g'nite :)
05:13 tehdark45 bye tons
05:13 wannabe1987 night tons
05:15 * eadthem is about to crash
05:15 eadthem cya
05:16 wannabe1987 night eadthem!
05:19 Carvagon joined #thegeekgroup
05:22 wannabe1987 high of 91 today....(sunday) o.o
05:23 wannabe1987 but currently it is 69 out
05:24 tehdark45 lol 69
05:24 StopMakingSense that is quite warm for 1:30am
05:25 Carvagon 75 here.  its gonna be quite hot tomorrow
05:28 wannabe1987 o shit...its a spider....from mars!  KILL IT!
05:29 SpiderFromMars :S
05:29 SpiderFromMars http://www.youtube.com/watch?v=kHgziac87-Y
05:29 BotSteve Title: TMBG - Particle Man (TSS) - YouTube
05:33 SpiderFromMars why are people afraid of spiders? i find them fascinating
05:35 wannabe1987 :shrug:  most are fine, its just the wolfman spiders down in florida that are fucking HUGE that creep me out
05:36 tehdark45 SpiderFromMars, arachaphobia
05:37 tehdark45 arachnaphobia*
05:37 SpiderFromMars archnophobia*
05:37 tehdark45 lol
05:37 SpiderFromMars its '-no-' not '-na-'
05:38 SpiderFromMars because it ain't nophobia!
05:39 wannabe1987 ...
05:40 tehdark45 lol
05:41 SpiderFromMars i guess it wasnt funny :\
05:41 wannabe1987 it ws, but its almost 2am
05:42 tehdark45 2am/drunk everything is funny
05:42 wannabe1987 no....
05:42 wannabe1987 i think i'm gonna lay down and sleep now....church is at 11a and that'll be here before i know it....
05:43 wannabe-zz night you two/all
05:43 tehdark45 bye wannabe-zz, dont forget to praise the lawd
05:43 Katemonster joined #thegeekgroup
05:47 JustoStyle joined #thegeekgroup
05:55 Hydroelectric joined #thegeekgroup
06:22 asnopus joined #thegeekgroup
06:29 mantere joined #thegeekgroup
06:37 einball YAAAAAAAAAYYYYY
06:37 einball Good morning vietnam
06:39 einball Good morning iraq?
06:40 MoxieMike_ Goooooooooooood Morning Vietnam
06:47 einball That's my Geek! :]
06:48 NothingNerd joined #thegeekgroup
07:14 y007-nb joined #thegeekgroup
07:29 Experimentonomen joined #thegeekgroup
07:31 Chipguy joined #thegeekgroup
07:43 Electricguy joined #thegeekgroup
07:43 Electricguy finally home!
07:43 BotSteve electricguy: I have the following messages for you:
07:43 Experimentonomen g'mornin peepz
07:43 BotSteve At 23 May 07:03Z, wannabe1987 asked me to tell electricguy here's your coffee
07:43 Electricguy lol
07:45 Electricguy lol.. i got 4 CB's to watch
09:21 * Experimentonomen yawns
09:22 * Electricguy plays need for speed most wanted with his logitech momo force steering wheel and pedals he got for free
09:23 * Experimentonomen watches Electricguy drive like if he stole it ;)
09:24 Electricguy lol :
09:24 Electricguy :P
09:25 switch joined #thegeekgroup
09:26 switch i need you input on a serious matter
09:26 Electricguy euro truck simulator is just wrong to play with a race steering wheel with paddle shifters.. XD
09:26 Experimentonomen haha
09:27 switch im building a pc its all going well its specced and designed
09:27 switch the problem is
09:27 switch i did plan to use the lanboy air case and trick it ouw with sleeved cables cold cathodes the works
09:27 switch http://static.scan.co.uk/images/products/1330027-a.jpg
09:27 switch was even gonna replace the side mesh with windows
09:28 switch that was untill
09:28 Experimentonomen ew
09:28 Experimentonomen skip those nasty ccfl lights, thats just gay :/
09:28 Electricguy not gay. but extremely lame and 2004-ish ;P
09:28 switch i found this
09:28 switch http://www.legitreviews.com/images/reviews/1809/CosmosIIUltra_45.jpg
09:29 switch heres a vid of it beside a asian lady
09:29 switch http://www.youtube.com/watch?NR=1&feature=endscreen&v=cuP9XMIjT6A
09:29 BotSteve Title: Newegg TV: COOLER MASTER COSMOS II Black Steel ATX Full Tower Computer Case Preview - YouTube
09:30 Electricguy what are you trying to say?
09:30 switch im not sure
09:30 Electricguy -,-
09:30 switch she just makes it look huge
09:31 switch anyway which do you think would look better
09:31 JA12 gaah. it's not even officially hot weather (19°C now), I'm drinking cola with ice, and I'm still sweaty
09:31 Electricguy i hate tha
09:31 Electricguy oops
09:31 Electricguy i hate the antec lanboy case.. so i would go with the cooler master..
09:31 Electricguy cooler master make pretty shitty quality cases though
09:31 switch yeah im partial to the cooler master
09:31 Electricguy In Win and Lian Li is WAAAAY better
09:32 switch pictures
09:32 Experimentonomen Electricguy, fun fact, the rackmount chassie i got on ebay is made by antek, same manuf as those pc cases :o
09:32 Electricguy i got a In Win BUC666 case. way better than fractal design, cooler master and those other half generic cases
09:32 Electricguy Experimentonomen, hehe cool :P
09:33 switch http://www.quietpc.com/images/products/ae-xpredator-all4-large.jpg
09:33 switch belive it or not the lanboy won me over from that case
09:33 Electricguy mkay
09:34 Experimentonomen my pc is built in an old fujitsu siemens scaleo 600 case
09:34 Electricguy check out the In Win BUC666 case.. i can recommend that. very good quality and it got hot swap SATA bays
09:35 switch wow that case is a love hate relationship
09:35 Experimentonomen Electricguy, that case has almost a bit of a military/army feel to it
09:35 switch i wanna love it but that hotsawp in the middle making the top and bottol split really kills it for me
09:35 Electricguy hehe :P
09:35 Electricguy top and bottom split?
09:36 switch errm
09:36 switch you know not contionus looking
09:36 Electricguy mkay
09:36 switch everything at the same level all the way down it dips in a lil then back out
09:36 Electricguy here are some pics from when i swapped to that case http://imgur.com/a/kEU5q
09:36 BotSteve Title: EG's new computer case - Imgur
09:37 switch i like the cosmos cause its so huge and yes im compensating lol
09:37 Electricguy from a junky old fractal design R1 case
09:37 switch awww its so cute
09:38 Experimentonomen http://www.youtube.com/watch?v=9T-U7H_U2mU <-- i hated that case from day one, it was so cheap and flimsy
09:38 BotSteve Title: How to retire an old computer - YouTube
09:41 switch so yeah i can either spend 100 on pimp gear for the lanboy and get a few days/weeks fun modding it and taking my time sleeving and stuff or get the cosmos spend roughly the same have to downgrade the ssd to 64gb to keep it on budget and then it will be built ina  few hours and thats that
09:41 Electricguy personally i would go with the cosoms cause the lanboy looks like crap
09:42 switch yah im thinking that too
09:42 switch that and im not 100% confident on my modding skills its only cable sleeving but id find a way to fuck it up
09:42 switch speaking of crap cable sleeving
09:42 Chipguy hey eg, bye eg... and all others
09:43 switch this is how one store advertises there cable sleeving kits
09:43 switch http://www.maplin.co.uk/cable-sleeving-kit-42919
09:43 BotSteve Title: Cable Sleeving Kit : PC Case Accessories : Maplin Electronics
09:43 Experimentonomen http://i.imgur.com/XAooN.jpg <-- my PeeCee inside
09:43 Electricguy maplin == overpriced shit
09:44 switch no arguments here
09:44 switch although for some items there not bad
09:44 switch i gan get arduinos for the same price i get them online
09:45 switch and they have had a couple lash drives at a decent enough price too
09:45 switch although ill admit i mostly like them cause im to lazy and impatient to order components online
09:47 switch ok so the cosmos it is then now i just gotta shoehorn a 128gb ssd back into the budget i could easily do it if i dropped the 1tb nas but then i wouldnt have a 1tb nas
09:49 asnopus joined #thegeekgroup
09:56 tehdark45 joined #thegeekgroup
09:57 * Experimentonomen flips switch
09:57 switch wrong type o switch
09:57 switch my handle is from the batch ile switch
09:58 switch file
09:58 asnopus joined #thegeekgroup
09:58 * Experimentonomen can flip any switch no matter what type :P
09:58 * switch wonders if he really cares about this enough to poit out switches that cant be flipped
09:59 switch meh forget it
09:59 Thermoelectric You can flip batch file switches in code.
10:00 switch fair point previous statement retracted
10:00 switch no idea why im still called switch despite the fact i havnt done anything in batch since i was 16
10:00 Experimentonomen which wasd last month, right ? ;p
10:00 switch even then it was a script that cleaned out a auto run virus
10:01 switch no were talking 4 years ago
10:01 tehdark45 there are alot of 92ers on here
10:01 tehdark45 lol
10:01 Experimentonomen <-- 85er
10:02 switch what about people between 68 and 70
10:02 tehdark45 1992 not 92 >.>
10:02 switch 68+1ers
10:02 switch 70-ers
10:02 switch i think thats what there called
10:02 tehdark45 their*
10:03 Experimentonomen we do have a guy in here that is around 70 years old
10:03 switch thats it
10:03 tehdark45 nein
10:03 grammer-jew im hated by grammer nazis
10:03 grammer-jew im also hated by jews now
10:03 grammer-jew im not a popular person all a suddden
10:03 grammer-jew maybe i should start a war
10:04 grammer-jew yup
10:04 tehdark45 i think Seroster needs yo fondle you
10:04 tehdark45 to*
10:05 Electricguy grammar*
10:05 catholic-choir-b ok
10:06 switch ok who registed my nick
10:06 tehdark45 some guy
10:07 Electricguy some other person that took the nick before you?
10:07 switch there was no other person
10:07 switch i didnt have this problem untill just now
10:07 tehdark45 Thermoelectric, who stole his nick
10:07 Electricguy dude.. there are more people then you who may want to use the nick "switch"
10:07 Thermoelectric tehdark45, A person?
10:07 switch yeah but how many were active in the last 5 mins since i changed nicks
10:08 switch like i said it wasnt registered when i logged in
10:08 tehdark45 cant you see thermo?
10:08 switch and you cant register it whilst its in use
10:08 Electricguy i have no idea.. but there are surely several thousands on freenode right now..
10:08 switch hmmmmmm
10:08 Thermoelectric It appears the nick switch was registered 1 year, 12 weeks and 1 day ago...
10:09 switch to what email
10:09 Thermoelectric It's protected.
10:09 Electricguy ...
10:09 switch if this is freenode i probably got the passwords wrong
10:09 tehdark45 it was to a@email.com
10:09 tehdark45 lol
10:09 Thermoelectric Probably, although the user switch was last seen 39 weeks ago...
10:10 Thermoelectric And user seen was apparently 30 weeks ago. Not sure about the differenc.e
10:10 switch hmm unlikeley then
10:10 Thermoelectric You should be fine using the nick though, doesn't look like anyone has wanted it for a while.
10:11 switch the part i dont get is usually ns take it back after a minute or two of not giving it a password
10:12 tehdark45 and you become unidemtifiedxxxxxxxxx
10:12 tehdark45 unidentified*
10:12 Thermoelectric I don't think that's freenode.
10:12 switch meh new nick time
10:12 Thermoelectric Usually you'll only be kicked from the nick unless the user who owns it ghosts you.
10:12 Thermoelectric not unless, if*
10:12 switch i could go back to my nick i had before my college buddy beat me sensless till i changed it
10:13 tehdark45 buddy and beat dont normally mix
10:13 switch sure they do
10:13 switch i beat off my buddy we were good buddies
10:13 switch see it mixes
10:14 Thermoelectric With the use of past tense.
10:14 switch isnt that correct
10:14 switch i beat him off
10:15 switch im not currently doing it
10:15 switch so were refers to the past tense
10:15 switch as in what can i say we were good buddies
10:15 Thermoelectric "I beat him off" does not sound correct.
10:15 tehdark45 it sounds nsfw actually
10:15 switch on so many levels
10:15 tehdark45 :P
10:16 switch you kidding me 99%of the internet is nsfw
10:16 switch facebook is nsfw
10:16 Thermoelectric Depends which parts of facebook.
10:16 Experimentonomen most of the internet is nsfw :P
10:16 Thermoelectric Some parts are fine, others, not so much.
10:16 switch all of them most employers dont let you do personal stuff with there internet
10:17 tehdark45 it should change to sfm. safe for mom
10:17 Thermoelectric Or safe for MoM
10:18 tehdark45 lol
10:18 Experimentonomen speaking of mom, wheres masterofmonks ? havent seen him here for weeks now
10:18 tehdark45 he stepped down fo
10:18 tehdark45 for reasons*
10:18 Experimentonomen hm
10:19 tehdark45 i duno what though lol. you can find him on tgg:nsfw
10:19 switch on the first day the internet was created on the second scams spam and popups were invented on the third day my mom clicked said popups and now we have emails every day for crap like penis pumps boob enlargers and weighloss pills all of which my mom clicks noobishly
10:20 switch on the 4th day i told my mom the internet was broken
10:22 Experimentonomen yuck
10:23 Thermoelectric Popups are the part of the internet that you should stay away from. Not many legitimate sites carry popups.
10:23 Experimentonomen and install adaware, it blocks popups
10:24 Electricguy or google chrome.. it automatically blocks popups and asks if you really want to open them
10:25 Thermoelectric Can also use ad block to block all ads.
10:27 tehdark45 adblock is a god and bad thing. most of the inernet is funded by ads, but i dont care, i dont wana see them
10:27 tehdark45 lol
10:27 tehdark45 good*
10:28 Experimentonomen last time i tried adblocker, i just kept getting greeted with "please turn off adblocker to view this site"
10:30 tehdark45 what sites did you go to?
10:37 switch who?
10:38 switch im not suprised that most malicious sites figured out ways to detect wether someone was using adbloker
10:38 Experimentonomen legit sites too, like youtube
10:38 Thermoelectric tehdark45, so? Every normal person who clicks ads won't install it, so they won't lose any profit...
10:39 tehdark45 true
10:45 switch even youtube?
10:45 Experimentonomen ads have become self aware
10:45 switch i dont mind popups
10:46 switch the 2 major ones that piss me of are
10:46 * Experimentonomen watches a fly fly around from window to window
10:46 switch 1 sites that copy your google search to trick you into going there and are nothing but ads for fake downloads
10:46 switch ie google intel blah blah blah driver
10:47 switch first result intel blah blah blah download
10:47 Thermoelectric I find that *all* the time when searching for electronics parts.
10:47 switch or even something random like how to overclock my hairdryer
10:47 switch and it copies it eactly
10:47 switch number 2
10:47 switch and this one really REALLY F***** REALLY pisses me off
10:47 switch surveys
10:48 Experimentonomen even legit sites sometimes pups up a survey
10:48 switch no no
10:48 switch i dont mean those surveys
10:48 switch i mean the complete this survey to view
10:49 switch the ones that force you to sign up for popups and services you dont want
10:49 switch they also come under complete theese offeres to view
10:50 tehdark45 also
10:50 Experimentonomen i completed one of those surveys once just to see what woulds happen, i believe it just sent me back to where i started or just belched up a new survey
10:50 tehdark45 experts exchange
10:50 tehdark45 when googling
10:50 switch general how are we doing or do you midn helping us improve surveys i dont ming
10:50 Experimentonomen because i entered in a phony email adress and such
10:50 switch actually
10:50 switch idk if its still there
10:50 switch but for a short period if you went to the verry bottom of experts exchange you could see the unblocked version
10:51 switch the site couldnt tell the difference between a google user and the spider and belched out the seo info which included the parts which were blocked
10:51 tehdark45 i just personal blocklist it
10:52 switch oh yeah i forgot
10:52 switch i called tech support last night
10:52 switch my internet was acting up
10:52 switch guess what the dip shits sugested
10:52 Thermoelectric Have you tried turning it off and on again?
10:52 tehdark45 i bock party poker, experts exchange and w3school
10:52 switch i wish
10:52 tehdark45 block*
10:52 switch well there was a few decent ones like picking a different wifi channel and increasing the speed
10:53 switch the one that pissed me off was he said go into services
10:53 Thermoelectric tehdark45, Why w3school?
10:53 tehdark45 is it plugged in?
10:53 switch and turn off firewall
10:53 switch i was like you serious
10:53 tehdark45 i dont like w3, they show depreciated tags
10:54 switch also ip flood detection
10:54 tehdark45 aka ddos
10:54 switch port scan detection
10:54 Thermoelectric Ah.
10:54 switch and a few other things
10:54 switch i thought ok maybe its so he can test
10:54 switch so i did it
10:54 switch no
10:54 switch that was his soloution
10:54 switch he then said your internet is fine now good bye
10:55 switch i was like ok you didnt even let me test it
10:56 switch basically there idea of ixing a proble is disabling virtually every thing that was put there to protect you
10:56 switch also ipsec and pptp protection whatever that is
10:56 switch wait no
10:57 switch ipsec and pptp pass through
10:59 switch there skating on thin ice with me originally i only went with them for there tv and broadband well there tv is expensive and got replaced by netflix and my love of online tv
10:59 switch and the second i ind fast broadband elsewhere ill be dropping that too
11:05 Experimentonomen hm i wonder how many real life years it'd take me to replicate a CD4017 in redstone
11:27 switch depends
11:27 switch are you going to be using valilla minecraft
11:28 switch cause minecraft unloads unused chunks so unless you can fit it in a chung your outta luck
11:28 switch me pesonally i wanna see a 3.6ghz i7 cpu i redstone
11:38 Seroster joined #thegeekgroup
11:38 Seroster BatSteve-Away. Don't be away you bastard.
11:53 KB3NZQ joined #thegeekgroup
11:57 mashpriborintorg joined #thegeekgroup
11:58 mashpriborintorg hiya
12:16 einball joined #thegeekgroup
12:16 Dougy joined #thegeekgroup
12:17 Experimentonomen g'dat mash
12:22 mashpriborintorg hi
12:22 mashpriborintorg okay, I've seen MIB3
12:22 mashpriborintorg not bad but it's missing the pretty black girl from the other episode
12:25 Auriga joined #thegeekgroup
12:32 Experimentonomen joined #thegeekgroup
12:36 mashpriborintorg I can't wait to receive this parcel http://cgi.ebay.fr/ws/eBayISAPI.dll?ViewItem&amp;item=310400572517&amp;ssPageName=STRK:MEWNX:IT&amp;_trksid=p3984.m1439.l2649
12:36 BotSteve Title: STI-69 Fernschreibverzerrungsmesser der NVA ! en vente sur eBay.fr (fin le 20-mai-12 22:20:31 Paris)
12:37 mashpriborintorg according to the shipping price it must be in the 20kg range :p
12:44 Monkeh|Lap It has begun: http://www.miamiherald.com/2012/05/26/2818832/naked-man-shot-killed-on-macarthur.html
12:44 BotSteve Title: Naked man killed by Police near MacArthur Causeway was ‘eating’ face off victim - Miami-Dade - MiamiHerald.com
12:46 mashpriborintorg Hmmm... time to check my ak-47
12:50 BitViper any javascript guru's in here ?
13:21 eg_lappy joined #thegeekgroup
13:51 eg_lappy ok, a trafo based PSU for the class a test amp is built
14:01 eg_lappy how the heck can it hum with 1/4 Farad of caps?!
14:02 eg_lappy a feedback line might help
14:02 Electricguy_ joined #thegeekgroup
14:10 injektion joined #thegeekgroup
14:21 Electricguy there we go. almost silent
14:22 Electricguy and operating at 30V instead of 24
14:22 mashpriborintorg electricguy, I found A 20 inch Samsung TFT in the street friday
14:22 Electricguy lol nice :)
14:22 mashpriborintorg very good body condition, 3 bad caps later it was working
14:22 Electricguy awesome :D
14:22 mashpriborintorg I now dial-screened :p
14:22 Electricguy i like this idea.. :P http://www.instructables.com/id/soldering-gun/
14:22 BotSteve Title: soldering gun
14:35 Electricguy joined #thegeekgroup
15:16 injektion joined #thegeekgroup
15:24 mashpriborintorg at least.... http://youtu.be/gOjTMA5VqLs
15:24 BotSteve Title: Captain's Blog 5-26-2012 Tour and Avionics - YouTube
15:26 mashpriborintorg that R2D2.... DO WANT
15:31 mantere joined #thegeekgroup
15:40 wannabe-zz mashpriborintorg: r2d2 was beeping, so omni went to sniff it out, and the owner of r2d2 bumped the controls so it moved and then omni proceeded to bark at r2d2.
15:40 Electricguy LOL :P
15:43 mashpriborintorg omni tooth vs R2d2 metal, who wins :p
15:54 wannabe-zz http://pinterest.com/pin/21884748159624685/
15:54 BotSteve Title: Whovian's Board / Awww...
15:55 mashpriborintorg I believe the big green thing at 23:20 in the blog is a torpedo guidance unit
15:58 mashpriborintorg I would give my kingdom for a similar one in my living room
16:01 injektion joined #thegeekgroup
16:10 eadthem joined #thegeekgroup
16:11 Carvagon joined #thegeekgroup
16:11 eadthem whats everyones thoughts about using refurb hard drives for RAID 10
16:13 Electricguy how old are they?
16:16 eadthem datecode 08131
16:16 eadthem i am unfamilar with a 5 digit datecode  it is nonstandard
16:16 injektion Julian date
16:16 eadthem i assume that means 2008 day 131
16:16 injektion eadthem, correct
16:17 eadthem i got a RAID 0  of 2x 250GB drives right now
16:18 Monkeh egrsteve: What the fuck, Steve? :D
16:18 eadthem id rather not break that raid up  as it holds a lot of data,  yet its semi tempting to
16:18 eadthem hows minecraft
16:21 SparkyProjects joined #thegeekgroup
16:31 wannabe-zz yay more firefly!
16:32 Seroster SparkyProjects, got me some DOT5.1
16:32 SparkyProjects That's good :)
16:32 tehchnowizard joined #thegeekgroup
16:33 tehchnowizard what is the sound of one hand clapping?
16:34 wannabe1987 silence
16:34 eadthem looks like i wont have a choice
16:34 eadthem its gonna be 300$ for RAID 10
16:34 Electricguy yeyy! my little class A test amp is up to almost 5A bias :P
16:34 Electricguy at 30V
16:34 tehchnowizard what i just said, s/cl/f/;
16:34 tehchnowizard ;)
16:35 Electricguy should give about 15-20Watts out
16:35 mashpriborintorg not bad
16:35 Electricguy lol.. thats 150Watts waste heat!
16:35 tehchnowizard surely someone here gets that regex joke?
16:36 mashpriborintorg well TGG needs a jet engine to go along the avionics
16:36 wannabe1987 donate one
16:36 mashpriborintorg I haven't got one.... but some years ago I was about to purchase a rocket engine fom a SA-2 missile
16:37 mashpriborintorg 500 euros... did not do it due to possible custom worries :p
16:37 Seroster Electricguy... 600watts in, 15 watts out?
16:37 Seroster .c 15/600
16:37 BotSteve 0.025
16:37 Seroster 2.5% efficiency? =D
16:38 mashpriborintorg even it is was demilitarized
16:38 Electricguy 600Watts in?.. err.. 150Watts in..
16:38 tehchnowizard pulsejet engine demo - pickle jar, rubbing alcohol, in a pot of water for cooling = fun
16:39 Electricguy .c 30*5
16:39 BotSteve 150
16:39 mashpriborintorg I don't like pickle jars
16:39 Seroster Err, misthought
16:39 Seroster But still, 150watts is a good coffee heater =)
16:39 mashpriborintorg I like titanium, nickel alloy and all serious stuff
16:40 Electricguy yepp
16:40 Seroster SparkyProjects, nichrome is pretty resistant to oxidization, eh?
16:40 tehchnowizard youtube for 'jam jar pulse jet' shows the fun
16:40 tehchnowizard .wa pi
16:40 BotSteve pi;3.1415926535897932384626433832795028841971693993751058...;pi is a transcendental number;[3; 7, 15, 1, 292, 1, 1, 1, 2, 1, 3, 1, 14, 2, 1, 1, 2, 2, 2, 2, 1, 84, 2, 1, 1, 15, ...];pi = 180 &deg;;pi = -i log(-1);pi = cos^(-1)(-1);pi = 4 sum_(k=0)^infinity (-1)^k\/(2 k+1);pi = -2+2 sum_(k=1)^infinity 2^k\/(binomial(2 k, k));pi = sum_(k=0)^infinity (50 k-6)\/(2^k binomial(3 k, k));pi = 2 integral_0^infinity 1\/(t^2+1) dt
16:40 Seroster .c pi to the last decimal
16:40 BotSteve Sorry, no result.
16:41 BotSteve 7
16:41 mashpriborintorg .aspirin botsteve
16:41 wannabe1987 lol
16:41 BotSteve *Noms*
16:42 tehchnowizard .wa sqrt(-1)
16:42 BotSteve sqrt(-1);i;r = 1 (radius), theta = 90&deg; (angle)
16:43 tehchnowizard .c sqrt(-1)
16:43 BotSteve i
16:43 tehchnowizard .c sqrt(pi)
16:43 BotSteve 1.77245385
16:43 tehchnowizard .c maxint
16:43 BotSteve Sorry, no result.
16:43 Seroster .c cos^-1*90
16:43 BotSteve Sorry, no result.
16:44 tehchnowizard .c sqrt(-pi)
16:44 BotSteve 1.77245385 i
16:44 Seroster .c cos^-1(90)
16:44 BotSteve Sorry, no result.
16:44 tehchnowizard i think cos needs a paramater
16:45 tehchnowizard .c cos(3.14)^-1*90
16:45 BotSteve -90.0001141
16:45 tehchnowizard .c cos(sqrt(-1))^-1*90
16:45 BotSteve Sorry, no result.
16:45 tehchnowizard .c cos(0)^-1*90
16:45 BotSteve 90
16:47 tehchnowizard .wa xaphod beebelbrox
16:47 BotSteve Zaphod Beeblebrox  (fictional character);species->betelgeusian, gender->male, place of birth->Betelgeuse, family relations->Ford Prefect (semi-half-cousin);year->title->medium, 1978->The Hitchhiker\'s Guide to the Galaxy->radio, 1979->The Hitchhiker\'s Guide to the Galaxy->book, 1981->The Hitchhiker\'s Guide to the Galaxy->television, 1986->Young Zaphod Plays it Safe->short story, 2005->The Hitchhiker\'s Guide to the G
16:47 Electricguy ooh :P DX sell decent GPUs! :D http://dx.com/p/asus-eah6930-dcii-2d4s-2gd5-amd-radeon-hd-6930-2gb-256-bit-gddr5-graphic-card-135110?utm_source=dx&amp;utm_medium=edm&amp;utm_campaign=20120528&amp;r=90000402
16:47 BotSteve Title: ASUS EAH6930 DCII/2D4S/2GD5 AMD Radeon HD 6930 2GB 256-Bit GDDR5 Graphic Card - Worldwide Free Shipping - DX
16:47 tehchnowizard .wa pangalactic gargleblaster
16:47 BotSteve Pan-Galactic Gargle Blaster;The Pan-Galactic Gargle Blaster is a fictional alcoholic beverage invented by Zaphod Beeblebrox, who is the only person able to drink more than three of them at one sitting., (The effect of one is like having your brain smashed out by a slice of lemon wrapped round a large gold brick, according to the novel The Hitchhiker\'s Guide to the Galaxy by Douglas Adams.)
16:48 tehchnowizard .wa bith
16:48 BotSteve DYNLRB1  (human gene);dynein, light chain, roadblock-type 1;BLP -> BITH -> DNCL2A -> DNLC2A -> ...;locus->chromosome 20 -> q11.21, strand->plus, coordinates->33104204 to 33128762;CGCAGAAAGGCACAGGACTCGCTAAGTGTTCGCTACGCGG, ...  AGCTGTTTTTCTTTAACTAAAAATAACCAAAATGCTTA;24.56 kbp  (kilobase pairs);Roadblock-1;10.79 kDa  (kilodaltons);SNP->gene position->frequencies, rs6088514->1368  (5\')->A : 99% -> G : 1%, rs10626123->756
16:48 wannabe1987 .wa 42
16:48 BotSteve 42;forty-two;XLII;101010_2;2&times;3&times;7;m->2->3->4->5->6->7->8->9, 42 mod m->0->0->2->2->0->0->2->6;42 is an even number.;42 has the unique representation 42 = 1^2+4^2+5^2 as a sum of 3 squares.;42 is the 5th Catalan number (Catalan(5)).;42 is the number of integer partitions of 10 (p(10)).;42 = 222_4 repeats a single digit in base 4.;e^(pi sqrt(42))~~695295413.0301 is a near-integer, and the ring of integers of t
16:48 BotSteve STOP TALKING TO ME I GOT A FUCKING HEADACHE!
16:48 tehchnowizard lol
16:49 wannabe1987 poor BotSteve
16:49 * wannabe1987 gives BotSteve migraine meds
16:49 tehchnowizard am i in the matrix now?
16:49 wannabe1987 yes
16:49 tehchnowizard 0___0
16:50 tehchnowizard follow the white rabbit
16:50 BotSteve Wannabe is.
16:50 tehchnowizard how about a nice game of chess?
16:50 BotSteve There is no chesspiece, tehchnowizard.
16:50 tehchnowizard play thermonuclear war
16:51 tehchnowizard how about a nice game of global thermonuclear war?
16:51 BotSteve *Launches missiles*  Your move, creep!
16:51 tehchnowizard lol
16:52 tehchnowizard .wa keags
16:52 BotSteve King  (leadership position)
16:53 tehchnowizard *beams up to the bridge of the Enterprise and uses phasers to knock missles out of the sky* :P
16:53 Seroster *  http://www.youtube.com/watch?v=XLal2HTifnM
16:53 BotSteve Title: Your move, creep - YouTube
16:53 * mashpriborintorg searches DX for missile defense system
16:54 mashpriborintorg errr... with their delivery delays, it may not be a good idea :p
16:54 Seroster Lol
17:02 tehchnowizard robot lab stairwell jacobs ladder should be cool
17:07 wannabe1987 mhm
17:07 Electricguy here are some pics of the class A with it's PSU http://imgur.com/a/sPv6K
17:07 BotSteve Title: Class A with PSU - Imgur
17:08 Electricguy ok, need to turn it off... 25C in here.. lol :P
17:09 mashpriborintorg eg, I think this ampmeter is older than you :p
17:11 mashpriborintorg now they're all plastic crap, you don't find stuff like this anymore
17:20 wannabe1987 ok shower time....be back on at the lab
17:27 lwq1996 joined #thegeekgroup
17:32 Experimentonomen there we go, all my stuff from old adress have been sorted through and brought home
17:32 Electricguy mashpriborintorg, yes, it's from the 40's sometime :P
17:32 Electricguy almost in mint condition
17:33 Electricguy Experimentonomen, http://imgur.com/a/sPv6K
17:33 BotSteve Title: Class A with PSU - Imgur
17:33 mashpriborintorg I may have a voltmeter from the 1920s somewhere
17:33 Electricguy hehe nice :P
17:33 mashpriborintorg maybe I did sell it, not sure, too many junk :p
17:36 Seroster That psu is UGLY
17:36 Electricguy dude, you don't have to state the obvious.. :P
17:36 Electricguy it's a test platform. so it doesn't have to look pretty
17:40 Experimentonomen Electricguy, how much hum ?
17:40 Electricguy almost dead silent after i added a feedback line
17:40 Experimentonomen oki
17:40 * Experimentonomen digs into a loop amplifier and discovers a TIP2955 and a TIP3055
17:47 Experimentonomen and a TDA2030
17:57 Electricguy oki
17:58 Electricguy i wanna mod my PC steering wheel :P
17:58 Electricguy thinking about adding toggle switches to enable/disable different extra buttons..
17:59 Electricguy a RPM meter and shift light would be awesome too
17:59 Electricguy but that have to interact with the game..
18:01 TENp01nt joined #thegeekgroup
18:04 Experimentonomen http://imgur.com/a/P0HKf <-- i started mapping out where the vent holes in the front will go
18:04 BotSteve Title: chassie - Imgur
18:05 eadthem man laying out computers suck
18:12 lwq1996 lol
18:12 wannabe1987 joined #thegeekgroup
18:13 lwq1996 WANNABE
18:13 wannabe|tgg ....
18:13 lwq1996 hi
18:13 wannabe|tgg hi
18:13 * lwq1996 noms on apple
18:14 Katemonster joined #thegeekgroup
18:14 lwq1996 KATE
18:14 wannabe|tgg hi kate
18:14 Katemonster hello
18:14 mashpriborintorg so what's going on at the lab today wannabe|tgg
18:14 wannabe|tgg if i'm not doing anything productive today can i take things apart?
18:14 wannabe|tgg mashpriborintorg: i was told moose is here, but other than that i have no clue
18:14 lwq1996 yes
18:14 wannabe|tgg ok
18:15 * wannabe|tgg goes to car to get thing
18:15 mashpriborintorg kiss the avionics for me, they are too beautifull
18:15 wannabe|tgg no
18:15 Cprossu lol
18:16 Cprossu mashpriborintorg some of them are moldy
18:16 Cprossu they were in a dude's basement for a long while ;D
18:16 mashpriborintorg Cprossu, the green thing in the blog must be a torpedo computer
18:16 mashpriborintorg a close up of nameplates should be good to have
18:17 wannabe|tgg whoa....cpro is alive!
18:17 Cprossu yeah alive and stuff is good
18:17 Cprossu well fed too
18:17 wannabe|tgg good
18:17 wannabe|tgg my washer works
18:17 mashpriborintorg hmmm.. I have some great avionics stuff also, but on a smaller scale, the parts stored downtairs is berry massive
18:18 mashpriborintorg *pretty
18:18 wannabe|tgg Cprossu: i scrapped all the desktops in the mdh yesterday
18:19 mashpriborintorg so you are a whole bunch of bad capacitors :p.... worthless.
18:20 Cprossu wannabe|tgg I hope you didn't get any cuts or stuff =(
18:20 Cprossu sharp edges on some of that stuff
18:20 wannabe|tgg few scrapes.  noting major
18:21 williamfr joined #thegeekgroup
18:22 Carvagon so how soon will it be before GH5 is completely gutted?
18:22 mashpriborintorg in a few days, there will be only the land piece left :p
18:23 Carvagon awesome
18:23 mashpriborintorg I hope they will stop before tho
18:24 Carvagon lol
18:26 Carvagon its a cool building.  kind of curious to see how it turns out
18:26 wannabe|tgg i think they will
18:27 SparkyProjects Maybe they are making it lighter so they can pick it up and move it to the lab car park :D
18:28 Carvagon lol
18:28 wannabe|tgg lol
18:28 mashpriborintorg it's within a 5 minutes walk from the lab isn't it ?
18:28 eadthem crap  im gonna have to buy a new monitor
18:29 eadthem you cant get cards with 2 VGA ports or DVI+A ports
18:29 Carvagon just get an adapter
18:30 SparkyProjects But you can buy an adaptor ftom DVI to VGA, i use them myself
18:30 eadthem they make HDMI or display port to VGA
18:30 eadthem ?
18:30 eadthem ya but you need DVI+A for that
18:30 eadthem all these cards have a DVI+A and ither displayport or DVI D
18:31 eadthem thus only 1 can be used as VGA
18:31 Carvagon what do u have right now?
18:31 eadthem 2x VGA
18:31 eadthem on a radeon x850 pro AGP 8x
18:31 eadthem 1 via a DVI+A adapter
18:31 Carvagon ok so what are u tryin to connect to?
18:32 eadthem a 17 inch CRT and a 21 inch LCD
18:32 eadthem both vga only
18:32 SparkyProjects I have the geforce 800GS, it has VGA + DVI + HDMI
18:32 SparkyProjects I use an adaptor in the DVI, and i run 2x VGA monitors
18:33 eadthem modern cards dont seam to have any vga
18:33 SparkyProjects Then get 2 adaptors if that's cheaper than monitors
18:34 Carvagon http://www.frys.com/product/4323395;jsessionid=aLlMvOpAvQgh3xGrj80hog__.node2?site=sr:SEARCH:MAIN_RSLT_PG
18:34 BotSteve Title: FRYS.com | PRIMELOGIC
18:34 Carvagon along those lines
18:34 eadthem accualy just found a 6850 that has 2x DVI+A
18:34 Carvagon cheaper than monitor thats for sure
18:34 eadthem those require DVI+A
18:35 Carvagon they make multiple types of adapters.  u just have to get the right one
18:35 eadthem http://www.newegg.com/Product/Product.aspx?Item=N82E16814121632
18:35 BotSteve Title: Newegg.com - ASUS HD7770-DC-1GD5-V2 Radeon HD 7770 GHz Edition 1GB 128-bit GDDR5 PCI Express 3.0 x16 HDCP Ready CrossFireX Support Video Card
18:35 eadthem see the end of the card
18:35 eadthem DVI ports
18:35 eadthem 1 has a + with 4 holes in the corners
18:35 eadthem thats DVI+A
18:35 eadthem 1 has a |   no holes
18:35 eadthem thats DVI
18:36 eadthem DVI cannot convert to VGA
18:36 eadthem unless it has +A
18:36 Carvagon that is wrong
18:36 Carvagon the link i posted is DVI-F to VGA.  use it at work
18:36 eadthem well it cant cheeply convert
18:37 eadthem the link you posted requires the 4 holes
18:37 eadthem ie  a DVI+A
18:37 eadthem http://en.wikipedia.org/wiki/File:DVI_Connector_Types.svg
18:37 BotSteve Title: File:DVI Connector Types.svg - Wikipedia, the free encyclopedia
18:38 SparkyProjects http://www.maplin.co.uk/dvi-to-vga-gender-changers-97442
18:38 BotSteve Title: DVI to VGA Gender Changers : Analogue Monitor Cables : Maplin Electronics
18:38 eadthem agan  thats good and all and i have those
18:38 eadthem but they wont work on a DVI-I or DVI-D
18:38 eadthem err  DVI-D
18:39 eadthem they require DVI-I or DVI-a
18:39 eadthem ive been calling  I and A the same   implying they have the 4 analog pins
18:41 eadthem and i guess there are a fue cards that have 2x DVI+A/DVI-I ports
18:41 eadthem but there dissapering fast
18:42 eadthem means i ahve to spend more on the GFX card than i wanted
18:42 Carvagon just get one then that is one dvi and one vga
18:42 KB3NZQ joined #thegeekgroup
18:42 eadthem ya those dont exist at all
18:42 Carvagon lol yes they do.  i just bought one
18:43 * KB3NZQ is under A SEVERE THUNDERSTORM WARNING REMAINS IN EFFECT UNTIL 300 PM EDT
18:43 eadthem what chip
18:45 wannabe|tgg careful, knives are sharp, they draw blood....
18:45 wannabe|tgg Cprossu: its not computer parts i need to be careful for....its my own knife.....
18:46 eadthem any issues with powercolor
18:46 eadthem in the past i would of bought ATI made cards
18:46 Carvagon http://www.geforce.com/hardware/desktop-gpus/geforce-gt-520
18:46 BotSteve Title: GeForce GT 520 - GeForce
18:47 switch joined #thegeekgroup
18:47 eadthem but sense AMD nolonger makes the cards (i saw there pick and place equipment on auction last month that built ATI cards, Sadly it wasnt universal insturments so i didnt get to bid :p)
18:48 eadthem 520 is a low end card  its not even in the benchmarks im useing
18:48 eadthem and ya that generation  VGA and DVI+A is common
18:50 Electricguy i got a ASUS GEFORCE GT 440 1GB GPU
18:50 Electricguy really worth the money
18:50 * eadthem pats Electricguy on the head
18:50 Electricguy a approx 117 dollar GPU
18:51 Electricguy performs really well for that price
18:52 eadthem i am going for med end gpu and high end cpu  but i wanted something that would run modern games at 30fps
18:52 eadthem with aa and af
18:52 Electricguy that is a mid range GPU
18:52 Electricguy slightly overclocked i get around 200FPS in minecraft with it. really not bad
18:54 eadthem gforce 440 15fps   radeon HD 6850  48FPS   choosen benchmark  AVP
18:54 eadthem 1xMSAA 8xAF
18:55 eadthem 1680x1050
18:55 eadthem ya thats what i dont get  i hear of pepole with FPS issues in minecraft on Cprossu's server i have no problems
18:55 eadthem and the mobo in this machine is 9 years old
18:55 Electricguy i got no problems either..
18:56 Electricguy my mobo and CPU are from 2010
18:56 eadthem the only reason im upgradeing is because im running in to games that refuse to run on this system  for reasons other than speed
18:56 Electricguy ahh i see
18:56 wannabe|tgg what happens when you open LCD screens?
18:57 eadthem http://www.youtube.com/watch?v=7LA_oWAwPQE
18:57 BotSteve Title: Laptop Autopsy- Toshiba Portect 3480CT | DactaDork Labs - YouTube
18:57 Electricguy open?
18:57 eadthem he opend one
18:57 eadthem sorta
18:57 Electricguy as in taking the glass plates apart?
18:57 wannabe|tgg well, whats inside?
18:57 mashpriborintorg befare of sharp metal frame
18:57 wannabe|tgg yeah.  its from a cd changer
18:58 wannabe|tgg i havve a first aid kit in my backpack
18:58 mashpriborintorg and mercury in the cfl
18:58 Electricguy the LCD only got liquid crystal gunk in between the plass plates.. nothing else
18:58 eadthem a deadly neruotoxin called liquid crystal
18:58 Electricguy other than that.. a shitty power supply and a control board for the panel
18:59 wannabe|tgg ok wont open in computer lab
18:59 Electricguy deadly? my ass! i tasted the crap when i was little.. :P
18:59 Electricguy didn't even get a little ill..
18:59 mashpriborintorg it it's a calculator like lcd screen, you can go like crazy, harmless
18:59 eadthem its only shitty if you get bit by it :p   1500V at 100khz = a frendly handshake :p
18:59 eadthem your hand will look like jar jar binks toung for a hour
18:59 wannabe|tgg Electricguy:you ate it? ita all makes sense now
19:00 Carvagon lol
19:00 mashpriborintorg someday I tried to get arcs from a cft inverter.... failure
19:00 Electricguy yeah.. i wanted to know what it tasted like.. lol
19:00 Electricguy CCFL inverters are lame.
19:01 wannabe|tgg now, if only i could desolder ....
19:01 wannabe|tgg it'd have switches!
19:01 wannabe|tgg or buttons
19:01 wannabe|tgg or whatefver
19:03 mashpriborintorg you may find what you need at the electronics lab
19:03 mashpriborintorg or ask ergsteve, he does soldering work at the master console sometimes
19:04 mashpriborintorg or get a hot air paint remover
19:05 wannabe|tgg he's not here, its sunday afaik
19:05 wannabe|tgg but theres a transformer....
19:05 tonsofpcs it is indeed sunday.
19:06 tonsofpcs no bill or batman around?
19:06 wannabe|tgg nope.  just a moose, jason, aaron, zozo and i
19:06 Katemonster wannabe: the proper term is "momentary switch"
19:06 wannabe|tgg its a cd player...i push it and it clicks
19:07 Katemonster yes.  button = momentary switch.
19:07 wannabe|tgg ok
19:07 switch hmm
19:07 wannabe|tgg hi switch
19:07 switch what about a toggle button
19:07 mashpriborintorg yeah, let me get. square body, 4 contacts pins, round button, meral piece around. regular crap.
19:07 wannabe|tgg mhm
19:08 mashpriborintorg *metal
19:08 tonsofpcs what are you trying to (un)build, wannabe|tgg ?
19:08 wannabe|tgg a part of a 5 disc cd changer
19:08 SparkyProjects You can get larching push buttons, used for on-off switches in a lot of equipment
19:08 tonsofpcs to make it work again or ?
19:08 Katemonster if the toggle function is done through wiring or software, it's still a momentary switch.  if the toggle function is mechanical, it's not momentary.
19:08 wannabe|tgg tear it apart, throw the plastic, recycle boards, find a transformer, maybe some other useful parts, pull off fuses, etc
19:09 Katemonster me wonders if switch is on top or bottom right now.
19:09 Katemonster lamnbgasdf
19:09 Katemonster can't type
19:09 switch im on top now lick my boots slave
19:09 tonsofpcs well, desoldering for recovery of the part is a llot easier than desoldering for recovery of the board
19:09 Katemonster i'm not a sub.  bite me.
19:09 mashpriborintorg tho there are gazillions of these buttons all around
19:09 * switch bites kates face of
19:09 wannabe|tgg she seems to be a dom....good luck
19:09 switch yum
19:10 mashpriborintorg not worth wasting time for them
19:10 tonsofpcs you just get hot solderign iron, push to solder point, pull part out w/ needle-nose pliers
19:10 Katemonster wannabe, did you see my post about my dream last night?
19:10 wannabe|tgg yes
19:10 wannabe|tgg i wanna watch the movie damnit
19:10 Katemonster LMAO
19:10 tonsofpcs switch: be careful, biting people's face off will get you shot by a half dozen bullets.
19:10 wannabe|tgg katemonster....starring in her own movie!
19:11 Katemonster doubtful.  but that will definitely make it into a graphic novel at some point, i'm sure.
19:11 wannabe|tgg ok
19:11 tonsofpcs (reference: <http://www.miamiherald.com/2012/05/26/2818832/naked-man-shot-killed-on-macarthur.html>)
19:11 BotSteve Title: Naked man killed by Police near MacArthur Causeway was ‘eating’ face off victim - Miami-Dade - MiamiHerald.com
19:11 Katemonster zombies.
19:12 wannabe|tgg also. i get the "useful" bits off....sd card readers, lcd screens, etc
19:12 wannabe|tgg and i learn.....a bit :P
19:12 Katemonster killa-x was amazed last night that i know what a pull-up resistor is.  >.>
19:13 wannabe|tgg ...
19:13 switch i cant wait to buy ma pc its gonna be epic
19:13 tonsofpcs I thought a pull-up resistor was the fat kid in gym class :-p
19:13 Electricguy LOL
19:13 Electricguy lulz
19:13 wannabe|tgg ...
19:13 Katemonster well, yes, but not the kind i was talking about.
19:13 switch hey
19:13 switch i haz mac question
19:13 * tonsofpcs was such a pull-up resistor at one point
19:13 switch how come your os's only cost 30 bucks
19:13 wannabe|tgg same, minus fat
19:13 wannabe|tgg our what?
19:14 switch os's
19:14 Electricguy switch, because it sux ballz?
19:14 wannabe|tgg what OS
19:14 switch osx
19:14 tonsofpcs actually, I probably resisted more before I was fat...
19:14 tonsofpcs switch: huh?
19:14 Katemonster but why is it that people are always amazed when i demonstrate knowledge of anything?  like i'm some kind of neanderthal and then everyone is shocked like, " *YOU* know how to use chopsticks?"
19:14 switch osx lion costs 30 bucks
19:14 switch win 7 costs like 90
19:14 wannabe|tgg ok, but we don't own osx
19:15 wannabe|tgg in fact i doubt any of our computers have it.....
19:15 Electricguy Katemonster, welcome to the club.. :P people ALWAYS try to teach me stuff i already know.. do i seem THAT retarded? :P
19:15 tonsofpcs switch: because apple knows that you bought the hardware already.
19:15 Katemonster possibly.  >.>
19:15 tonsofpcs When you buy a PC pre-loaded with Windows, you probably pay just as little (if not less).
19:15 switch tonsofpcs: they hope you have anyway i shall elaborate
19:16 tonsofpcs if you go to upgrade, you pay less...
19:16 tonsofpcs since you already bought the hardware, this is clearly an upgrade and they've already made profit off of your use, so it's not an issue for them
19:16 tonsofpcs (they deny that hackintosh is legal and thus have no reason to account for it)
19:17 switch yeah its only illigal in apple hq
19:17 tonsofpcs (also, how many people actually buy OS X for hackintosh?)
19:17 switch alot
19:17 Electricguy i wouldn't
19:17 switch i would
19:17 Carvagon no way
19:17 tonsofpcs I wouldn't pay $30 for an OS that won't work fully.
19:18 Electricguy i would most likely get it from somewhere else as my hackintosh would only be a test to see if it works..
19:18 switch it justs breaks thee licence aggrement not and state or nationl laws and apple wont waste there time suing people for doing hackintosh
19:18 Katemonster anyone want to send me a 20mhz crystal?  :(
19:18 tonsofpcs no, they won't, especially if they already made $30 off of someone
19:18 Electricguy MHz ;)
19:18 switch actually from what ive seen hackintosh has a decent compatibility rate theese days
19:19 Electricguy what do you need a 20MHz xtal for?
19:19 Katemonster i know that, Electricguy.  i'm too lazy to capitalize.
19:19 Electricguy lulz :P
19:19 tonsofpcs switch: walking and running are two different things.  hackintosh tends to crawl...
19:19 Katemonster pic microcontroller
19:19 Electricguy ahh!
19:19 Electricguy going fast, are we? ;P
19:19 switch tonsofpcs: not from what ive seen ive seen alot of videos from people whi get it running flawlessly just by using chimera
19:19 * Katemonster rolls eyes
19:19 Electricguy true shit! http://a5.sphotos.ak.fbcdn.net/hphotos-ak-ash3/537673_415927541781407_1583783595_n.jpg
19:20 tonsofpcs also, you're bound to be buying software from the app store....
19:21 switch and thats a problem because?
19:21 tonsofpcs and once you buy OS X you need iLife and/or iWork to do anything useful
19:21 JUSTPIE joined #thegeekgroup
19:21 tonsofpcs who said it was a problem? it's a reason that they don't need to charge $468368498 for the OS
19:22 switch hey i have 2 options 1 hackintosh
19:22 wannabe|tgg darn.  now i have nothing to take apart...
19:22 switch 2 use windows 8
19:22 switch windows 8 makes me cry
19:22 tonsofpcs why are those the only two options?
19:22 Electricguy Katemonster, got any fun µC project going?
19:22 tonsofpcs wannabe|tgg: why not?
19:22 wannabe|tgg because if i take anything in the computer lab apaprt, zozo will eat me
19:22 switch because option 3 is worse than osx or software compatibility
19:22 Katemonster ?
19:23 Electricguy as you needed a crystal..
19:23 wannabe|tgg LINUX!
19:23 switch linux dont like me
19:23 switch well over 50% of my games dont work on it
19:23 switch at least in hackintosh i could use parrales or use the dual boot
19:23 tonsofpcs linux, bsd, heck BeOS or AROS or ..., Windows 7, Vista, XP, 2000, ...
19:24 tonsofpcs you could dual boot or run a virtual machine on a linux host too....
19:24 Katemonster Microchip sent me a free PIC.  I have a breadboard it fits into.  Therefor, I want to start it up.  The rest of the components I can salvage from scrap PCBs, but I don't have a 20MHz cyrstal which is apparently required to make the on-chip USB interface work.
19:24 Electricguy ooh i see! sounds like fun :)
19:24 Electricguy this is so much awesome! http://www.youtube.com/watch?v=C4OV2UofPFg&amp;feature=related
19:24 BotSteve Title: Portal's 'Still Alive' Played by Fiber Laser - YouTube
19:24 Katemonster Beyond that, I have no idea what I'm doing.  :3
19:25 Electricguy lulz XD
19:25 tonsofpcs Katemonster: how close to 20 do you need it?
19:25 Electricguy a flashing LED is always a good start
19:25 Katemonster why?
19:25 Electricguy simple
19:25 Electricguy good to see if it works at all too..
19:26 Katemonster the datasheet on the chip and every hello-world schematic i've seen calls for a 20MHz chip.  they don't say anything about tolerance :/
19:26 Electricguy 8MHz works fine too
19:26 tonsofpcs well, you should be able to find a 10.7 MHz xtal easily and I don't think it would be too hard to double...
19:26 Electricguy dunno about tolerance either
19:26 Katemonster i'd just get it off mouser or newark or something but I don't want to spend $10 shipping on a $0.25 part
19:26 Katemonster >.<
19:27 Electricguy good lord!
19:27 Katemonster nor do i have the cash to spare for such a thing.
19:27 tonsofpcs I wonder what the standard xtals are on ISA or PCI NICs...
19:27 Electricguy crystals use to be found is most electronics with some sort of processor..
19:27 Katemonster i have a 200MHz crystal.  can i drop that by .1x?
19:28 tonsofpcs You should be able to double and half relatively easily... not sure about 10:1....
19:28 Katemonster at least i think I do.
19:29 Katemonster it's on the controller board for an old PATA hard drive
19:29 Electricguy 10:1 is a HUGE step
19:29 tonsofpcs Electricguy: well, 1:10
19:29 Electricguy and everything above 30MHz is a bit tricky to work with
19:29 tonsofpcs XTAL is 10x desired
19:29 Electricguy yeah yeah
19:29 tonsofpcs yea, probably will have line termination issues causing shapes to change and such
19:29 wannabe|tgg crystal?  y'all have me confused.
19:30 Katemonster quartz crystal oscillator to generate a timing signal.  tiny, high-speed metronome.
19:30 tonsofpcs wannabe|tgg: little cut piece of a crystalline substance (usually quartz, hence 'quartz timing' watches) that oscillates at a desired frequency
19:30 wannabe|tgg cool
19:30 Electricguy http://www.sparkfun.com/images/tutorials/BeginningEmbedded/3-Oscillators/Xtal-US.jpg
19:30 Electricguy like that
19:31 Electricguy or with a taller can
19:31 tonsofpcs http://en.wikipedia.org/wiki/Crystal_oscillator << the picture there is what they often look like
19:31 BotSteve Title: Crystal oscillator - Wikipedia, the free encyclopedia
19:31 tonsofpcs although, for high precision, they're often in 'ovens'
19:32 Electricguy and if you are even geekier.. get a Rubidium frequency standard box
19:32 tonsofpcs (as things heat and cool, they change and properties change, an oven is used to keep a crystal at a temperature....)
19:32 tonsofpcs Electricguy: why should I?  The government runs them for me and I can pull the pulses off of WWV(B) and/or GPS...
19:32 tonsofpcs :)
19:32 Electricguy because you get a few ms delay by doing that?
19:33 tonsofpcs who cares if a constant frequency oscillator is delayed?
19:33 Electricguy you don't get like 0.0001% accuracy with GPS :)
19:33 Electricguy some seem to do as those devices exist...
19:33 tonsofpcs I get 10MHz from GPS at minimum.
19:35 Katemonster R200KAA5  <--  what it says on the oscillator on the hard drive
19:35 tonsofpcs I time things to a few tens of nanoseconds of tolerance (or tighter) using GPS btw.
19:35 Electricguy but still. not as good as a rubidium freq standard box.. it's highly overkill for hobby use.. but some applications require that accuracy
19:35 Katemonster i have two of those
19:36 Electricguy and second hand Rubiduim freq standards go for around 50 bucks on ebay
19:36 Electricguy kate: a big can with 4 legs?
19:36 tonsofpcs a single rubidium frequency standard is nowhere near as good as a multi-sat GPS lock
19:36 Katemonster no.  small can with 2 legs like in the pic you linked to.
19:36 Electricguy ahh
19:37 Electricguy well, sad that the freq is waaay off
19:37 mashpriborintorg I would like to get a vintage mil-spec rubidium module, not the crappy ones for mobile phone networks
19:37 mashpriborintorg the "good" ones come in black hammertone cube shape casing
19:38 tonsofpcs could kate use a L-C oscillator (or perhaps a 555) instead of an xtal?
19:38 Electricguy a 555 only goes to about 1MHz..
19:38 Katemonster i don't know enough to answer that question.  keep in mind, i'm a gunsmith and a mechanical engineering student
19:38 Electricguy not sure about L-C.. but i don't think it works
19:40 Katemonster i *think* what i read is that you can use other speeds of crystals or ceramic resonators to run the USB, but it requires changing the firmware on the chip to match, and from the factory it's set to use a 20MHz crystal
19:40 tonsofpcs are there any other markings on it or just R200KAA5?
19:40 Katemonster that's it.
19:41 mashpriborintorg and Google isn't our friend with it
19:41 Electricguy nah
19:42 tonsofpcs got a sillyscope?
19:42 Katemonster negative.  only riflescopes
19:43 Katemonster http://ww1.microchip.com/downloads/en/devicedoc/39632e.pdf
19:43 Electricguy crapetycrap that i live in Sweden.. i got a bag of 20MHz xtals here... -,-
19:44 Katemonster i have the PIC18F4550 in the 40-pin through-hole package
19:44 Electricguy and other various freq's
19:44 tonsofpcs I suppose Katemonster may have the tools to fabricate a resonantor...
19:44 Electricguy lol
19:44 tonsofpcs *resonator
19:44 Katemonster and i'm working off this schematic http://www.create.ucsb.edu/~dano/CUI/MediaInterfaceCircuit.jpg
19:45 Katemonster i found a bunch of ceramic resonators but they are all at really weird frequencies
19:45 Electricguy hmmm.. some PICs got built in resonators
19:45 Electricguy not sure if that one got it though
19:45 tonsofpcs Electricguy: could you use spare pins on the PIC to input knownfreq and output 20M?
19:45 Katemonster it does but you need to have an external timing signal to connect it to USB
19:45 Electricguy and if the PIC is set to a external xtal atm the internal one isn't going to do jack
19:46 Electricguy tonsofpcs, nah, the DACs in these only goes up to about 40kHZ if the PIC is overclocked
19:47 mashpriborintorg watching the blog one more time for the avionics stuff. where's my passport I need to go see it myself
19:47 Electricguy lol
19:47 tonsofpcs I still think a 10.7M should be easy to find and double it for 21.4 ...
19:47 tonsofpcs mashpriborintorg: avionics stuff?
19:47 Katemonster and Electricguy, yes, my goal is to blink some LEDs with it.  if i manage that, i will feel successful.  i have low standards.  XD
19:47 Electricguy lol :P
19:47 Electricguy you gotta start somewhere :P
19:48 Electricguy i almost crapped my pants the first time i made a program for a µC.. XD
19:48 Katemonster lol
19:48 Electricguy the first thing is always special :P
19:48 mashpriborintorg yeah tonsofpcs I'm a fan. I have a collection of it but the stuff they got is awesome
19:48 Electricguy kate, look around in other electronics for crystals
19:48 Electricguy they use to be found here and there..
19:48 Katemonster i have been.
19:49 Katemonster you want a list of what i've found?
19:49 Electricguy no it's ok :P
19:49 Electricguy wont make any sense anyways :P
19:49 Electricguy check ebay for xtals
19:49 Katemonster lots of cyrstals and resonators.  nothing at frequencies i need
19:49 wannabe|tgg mashpriborintorg let me know when your flight comes in :P
19:50 Katemonster trying to do this without spending money.  since, you know, i don't have any.
19:50 Electricguy kate, http://www.ebay.com/itm/10pcs-20MHz-20-000MHz-20M-HZ-Crystal-Oscillator-HC-49S-/251068117960?pt=LH_DefaultDomain_0&amp;hash=item3a74d373c8
19:50 BotSteve Title: 10pcs 20MHz 20.000MHz 20M HZ Crystal Oscillator HC-49S | eBay
19:50 Electricguy not even a dollar for 10 of them.. :P
19:50 Electricguy and free shipping
19:50 Katemonster ....
19:50 Katemonster :o
19:51 mashpriborintorg and deliveru in a random amount of time :p
19:51 mashpriborintorg from 1 week to 3 months
19:52 tonsofpcs s/months/decades
19:52 Electricguy lulz
19:52 Experimentonomen i have some 68.something MHz Vacom oven compensated xtal module
19:52 Experimentonomen i think that takes the prize as weirdest freq ;p
19:52 Electricguy mash, tons, nah.. :P 14 days or you get the money back.. XD
19:52 tonsofpcs VHF?
19:53 Electricguy 68MHz sounds like taxi/police radio stuff :P
19:53 tonsofpcs 68 sounds like half of the aircraft band...
19:53 Electricguy i got some 3.6864MHz xtals here
19:53 wannabe|tgg ya'll have weird things
19:53 Experimentonomen btw i for three free speakers today, a sony center channel and two sony surround boxes
19:54 Electricguy i got a rectifier diode from a train too.. lol
19:54 tonsofpcs Electricguy: chroma!
19:54 Electricguy the size of a coke can :P
19:54 Electricguy chroma?
19:54 tonsofpcs oh, wait, that's 3.57....
19:55 Electricguy 8MHz is an awesome frequency
19:55 Electricguy .. for overclocking gameboys!
19:55 tonsofpcs oh, 3.6864 is CDMA
19:56 Electricguy ahh
19:56 tonsofpcs http://en.wikipedia.org/wiki/Crystal_oscillator_frequencies :D
19:56 BotSteve Title: Crystal oscillator frequencies - Wikipedia, the free encyclopedia
19:57 tonsofpcs it's also apparently used for modems to generate different baud rates
19:57 Katemonster ..................
19:57 Electricguy 20MHz is for 10Mbit ethernet..
19:57 * Katemonster goes to find an ethernet card
19:57 Electricguy kate, get some old network cards and such stuff..
19:58 tonsofpcs ok, so I wasn't imagining 20 and 200 as being ethernet
19:58 Electricguy me neither
20:06 tonsofpcs apparently I was... fast ethernet tends to run on an XTAL @ 50
20:06 tonsofpcs *checks cards*
20:08 Katemonster no such luck
20:08 Katemonster BUT
20:08 tonsofpcs 10 base cards all have 20.000, the two 100 base cards have (one) 25 and (one) something inside a chip
20:08 Katemonster i found a 10MHz crystal on an old SCSI card
20:09 Katemonster it's in a rather large 4-pin can though
20:09 tonsofpcs Katemonster: no old 10base2 or 10base5 or 10base[undefined] cards? (the kind with BNC or DB15 connectors)  Those should have 20s....
20:09 Katemonster weeeeeeell
20:09 Katemonster kind of
20:10 Katemonster Digital Equipment Corp. DECserver 90TL
20:10 Katemonster that has a BNC connector on it
20:10 tonsofpcs alternatively, apparently bluetooth uses 19.8 and some data modems may have 20.2752....
20:10 Katemonster i'm not sure I want to scrap it though.
20:11 Electricguy BNC..
20:11 Electricguy yeah, thats an old card. lol
20:11 Katemonster it's not a card
20:11 tonsofpcs it's 8 modems and a 10Base uplink
20:11 Electricguy what is it then?
20:11 Electricguy a switch/hub?
20:11 tonsofpcs at least, I think it's 10Base.. might be one of those oddball DEC products
20:12 Katemonster what tonsofpcs said, i think
20:12 Electricguy ahh
20:12 tonsofpcs well, not exactly modems... serial terminal connections
20:12 tonsofpcs "Designed for asynchronous connections up to 57.6 kbit/s to UNIX, ULTRIX, VMS, DOS and multi-vendor network services. The DECserver 90TL supported TCP/IP protocols and several remote management systems.
20:12 Katemonster it has eight JR45 connectors in the front, which came with adapters stuck in them converting them to RJ13 (i think?)
20:13 Electricguy myeah.. a shame to trash that
20:13 tonsofpcs I wouldn't tear that apart.
20:13 Katemonster it came off a DEC AlphaStation rack
20:13 Electricguy get some junky old ethernet card instead
20:13 tonsofpcs you don't have any old DEC ethernet cards though? those are a dime a dozen...
20:13 Katemonster it's in very pretty condition and i have the power supply for it.
20:13 tonsofpcs (and even linux dropped default-support for them in most distros...)
20:14 Katemonster i still have the AlphaStation too, though i kind of doubt it still works.
20:14 tonsofpcs oo
20:14 Katemonster it's been in storage for a long time
20:14 Katemonster and i don't have a serial terminal to find out
20:14 tonsofpcs clone your alphastation's HDD for me?! I have one that I can't boot...
20:14 Katemonster i don't think it has a drive in it  :(
20:14 tonsofpcs darn
20:15 tonsofpcs you probably have the good firmware though if it's an actual alphastation
20:15 tonsofpcs mine is an evaluation board....
20:15 Katemonster all i know is it doesn't have VGA capability and i have to run it through a separate serial console
20:15 tonsofpcs yea, you definitely have the good firmware then.
20:15 Katemonster ah.  yeah there's a bit of a story to this thing
20:15 Katemonster a friend of mine went out yardsale cruising one day.
20:15 Katemonster he calls me up and says GET YOUR TRUCK AND GET TO MY HOUSE NOW
20:16 Katemonster he takes me over to this garage sale and inside the garage is a complete server rack tower
20:16 tonsofpcs note: there's still an HP support division (with 2 guys in it) dedicated to alpha products.  They love to talk but are required to ask every 10 - 20 minutes "do you want to pay for this call?" (you can keep saying "no") :)
20:16 Katemonster the sign on it says "if you can move it, you can have it"
20:16 Katemonster LOL
20:16 Electricguy lulz!
20:16 Katemonster it was a TV advertisement injector.
20:16 Electricguy i would try to move it with my eyelash if i had to!
20:17 Katemonster the 220v connection on the UPS was melted from a power surge and it was so old the company just wrote it off as a loss to replace it.
20:17 tonsofpcs Katemonster: want some 1" decks? (Ampex VPR-6).  I believe that they are in the "if you can get them out, you can have them" mode... I'd have to check with the bossman though
20:17 Katemonster LOL
20:17 Electricguy LOL! http://1.bp.blogspot.com/-vD8ExAZYfh4/T8AHu0tO8ZI/AAAAAAAA1YQ/XwY2dgPCK0k/s640/What_You_Amimals_See_007.jpg
20:18 tonsofpcs we just threw a bunch of OLD racks into scrap metal recycling
20:18 tonsofpcs Electricguy: no, your hands need to be on it for her tto see that
20:18 Katemonster as fun as that would be, i don't have a pickup truck anymore :(
20:18 Electricguy lol ok then :P
20:19 tonsofpcs Katemonster: I don't know that a pickup truck would handle them....
20:19 Katemonster maybe mom's work would take them.  the Washington State Digital Archives collects a bunch of old tech shit for display.
20:19 tonsofpcs I think they need to stay upright, they're like 40" wide and 30" deep... and full-rack-height and heavy
20:20 tonsofpcs they're not all that rare though
20:20 Katemonster anyway.  my friend took all the SCSI hard drive arrays, i got the actual alphastation and the DECserver 90TL and some of the other peripherals, and we trashed the tower since we didn't have anywhere to store it.
20:21 tonsofpcs the scsi drive arrays might be needed to boot the alphastation...  the 90TL probably interfaced serial terminals for programming and maybe playback control
20:21 Electricguy lulz XD http://www.n0.se/f/m/16158_1338031655.jpg
20:21 tonsofpcs alternatively, the alphastation might just be configured as 8 dumb-terminals...
20:21 tonsofpcs something to present to the data terminals
20:22 Katemonster i'd have to blow out the alphastation, it might still start, but all the cards were taken out and have probably suffered ESD death
20:22 tonsofpcs Electricguy: desaturation might be useful....
20:23 Electricguy lol perhaps :P
20:23 Katemonster i found a debian distro made for 64bit alpha systems, but as i said it needs to be run from an external serial terminal and i don't have such a thing.
20:23 Katemonster however if any of you want to HELP me try to start it... ;)
20:23 tonsofpcs debian is still built for alpha, i think
20:23 tonsofpcs NT4 will run on alpha also
20:23 Electricguy OM NOM NOM! http://www.n0.se/f/n/10178_s6300938.jpg
20:24 tonsofpcs NT4 requires "AlphaBIOS" (firmware that preloads the NT hardware addressing scheme, really)
20:24 tonsofpcs deb will run on AlphaBIOS or SRM (the standard that BSD and other stuff run on)
20:25 tonsofpcs my alpha's issue is that it's stuck on AlphaBIOS and there's an issue with how the NT4 installer sees the drives so it can't install; if I had a drive with NT4 Alpha pre-installed, it'd work fine
20:26 tonsofpcs and I believe there's a Win 2k build for Alpha but no installer (must be upgrade-in-place on NT4).... or maybe that was to downgrade to 3.51... I forget...
20:26 Katemonster well i can look in it and see if it has a drive, but if it does it will be SCSI and I don't have any way to clone it, but if it does and you wanna pay for shipping i'll send it to you  :)
20:27 tonsofpcs my Alpha has an onboard IDE controller, not SCSI!  (which makes it an even bigger pain because every other Alpha board ever made was scsi only)
20:27 Katemonster ouch
20:27 tonsofpcs and it's a true IDE controller, no ATAPI.  I needed a SCSI card and a SCSI CD drive to try to install NT4...
20:28 tonsofpcs yea, it's a fun little useless animal
20:28 tonsofpcs before I had it, it was used with NT4 to render 3D animation
20:28 tonsofpcs but they kept the drive
20:28 tonsofpcs (or the drive died maybe?)
20:28 Katemonster unrelated question, how much heat does it take to melt solder?
20:28 tonsofpcs there is a #alpha on freenode and the folks there  were quite helpful
20:29 JUSTPIE left #thegeekgroup
20:29 Electricguy Katemonster, depends on the solder type
20:29 Electricguy but usually between 350-400C
20:29 tonsofpcs enough to get the solder to its melting point (most normal solders are in the 300C-375C range)
20:29 Katemonster i'm wondering if i can melt a small bit of it in a metal can over a candle and use that to tin the ends of some wire
20:29 Katemonster i'm still without my soldering iron.
20:29 Electricguy nah. wont work that well unless you dip the wires in flux before
20:30 wannabe|tgg how much trouble can a bored geek get into on sunday at tgg?
20:30 Katemonster i'm tempted to drill and tap the end of a steel bar to take the soldering tip and heat that in an oven
20:30 Katemonster i have flux
20:30 tonsofpcs You could heat the wire with a lighter and then just push the solder into it.... in a pinch, one can heat a needle with a lighter and use it to solder
20:30 tonsofpcs wannabe|tgg: a lot? :)
20:30 wannabe|tgg ik....but me?
20:30 wannabe|tgg i don't know much....
20:30 Electricguy yeah soldering wires with a regular lighter is doable :)
20:30 Katemonster ....how much trouble did you get in?
20:31 tonsofpcs wannabe|tgg: that makes you dangerous :)
20:31 Katemonster and the flame won't contaminate the solder?
20:31 wannabe|tgg kate: none....i wheeled myself around robotics in a wheelchair...my arms hurt
20:31 tonsofpcs Katemonster: flame from a butane lighter shouldn't.  I'd be more worried about candle flame
20:31 Katemonster okay.
20:31 tonsofpcs just don't catch the sheath on fire
20:32 Katemonster lol
20:32 tonsofpcs (which is why one normally heats and uses a needle... wrap with tape far enough from the tip to hold it)
20:32 Katemonster i've used a lighter to heat heatshrink tubing before, and accidentally set it on fire.
20:32 tonsofpcs there's a trick for preventing that (actually, two tricks, depending on how much of a rush you're in
20:32 tonsofpcs )
20:33 Katemonster anyway.  i'm hoping i have solder around here somewhere.  i have an iron tip, but not the iron itself.  and i have a tin of flux, i think
20:33 tonsofpcs #1: keep lighter on and keep heatshrink an inch above the flame;  #2:  leave lighter on until you can't hold it anymore, then off and put heatshrink where the flame once was.  If you don't care about using the lighter again, you could even touch it to the metal
20:33 Katemonster lol
20:34 Katemonster annoying, i have electric stove range here, not gas
20:34 tonsofpcs if you have rosin-core solder, you don't need external flux unless you're trying to dip the wires into molten solder.
20:35 Katemonster i'll have to go look.  i'm also going to look through some more boxes for a 20MHz crystal.  if worse comes to worse, can i double the 10MHz crystal?
20:35 Katemonster and what's the implication of it being in a 4-pin housing?
20:35 tonsofpcs I suppose you could build an insulating handle for the iron tip and heat that over a flame....
20:35 tonsofpcs no clue, Electricguy is the electric guy :)
20:36 Katemonster lol
20:36 Electricguy whuts?
20:36 Electricguy ned to read the scroll
20:36 Katemonster oh and also, on the same board as the 10MHz crystal, there's a 3.6865MHz one :)
20:37 tonsofpcs Katemonster: modem?
20:37 Katemonster SCSI card
20:37 Electricguy a crystal with 4 pins?
20:37 tonsofpcs Electricguy: how do you double 10MHz crystal to 20MHz?
20:37 Katemonster ISA
20:37 Katemonster yes
20:37 tonsofpcs and how do you 4-pin  crystal attach?
20:37 Electricguy thats a crystal oscillator
20:37 Electricguy apply power and it outputs a given frequency
20:37 Electricguy i don't know how to double the freq
20:38 Katemonster damn.
20:38 Katemonster i found a few 24MHz also
20:38 Katemonster ah well.  going to go look some more.  bbs
20:38 Electricguy oki
20:38 Electricguy good luck! =)
20:39 wannabe|tgg http://www.wbir.com/comments/220871/16/7-year-old-boys-suicide-shocks-Detroit-community
20:39 BotSteve Title: 7-year-old boy's suicide shocks Detroit community | wbir.com
20:39 tonsofpcs Katemonster: could ask in ##electronics , peoples there is smart :)
20:40 Electricguy we are all smart.. :P
20:41 Electricguy Experimentonomen, wazzap?
20:45 Electricguy hmmm.. i'm gonna try schottky diodes in the rectifier on my class A test amp
20:46 Electricguy schottkys affect the sound quite a lot in some circuits apparently
20:46 Electricguy (not audiophile BS)
20:50 BatSteve Seroster: yo
20:51 tesla4d joined #thegeekgroup
20:51 Electricguy honk honk batsteve
20:51 BatSteve howdy Electricguy
20:53 Electricguy whutz up?
20:59 wannabe|tgg sitting between zozo and aaron playing DII, one has better audio/speakers, but i hear allllll the sounds....like if one is throwing something to another.  its pretty cool
20:59 wannabe|tgg hi BatSteve
21:01 BatSteve howdy wannabe
21:04 wannabe|tgg hows BC?
21:08 DeKemp joined #thegeekgroup
21:08 BatSteve Hot
21:08 BatSteve that's mostly it
21:08 DeKemp joined #thegeekgroup
21:09 DeKemp Hi there
21:09 wannabe|tgg hi DeKemp
21:09 wannabe|tgg .weather kgrr
21:09 BotSteve Scattered, 80.6℉ (27℃), 29.99in (1012mb), Fresh breeze 20kt (↑) - KGRR 20:53Z
21:09 wannabe|tgg i don't believe you
21:10 wannabe|tgg its 88 out
21:10 wannabe|tgg and the high was 89 earlier
21:10 DeKemp do they use  knots for airspeed in the us?
21:10 wannabe|tgg i don't know, BatSteve?
21:10 wannabe|tgg i assume so....
21:12 DeKemp What is a good place to sleep in the grand rapids area? planning to go to tgg for 2-3 weeks :)
21:12 BatSteve DeKemp: we do
21:13 DeKemp ?
21:13 wannabe|tgg DeKemp: PM
21:21 Seroster BatSteve.
21:25 BatSteve hola
21:28 Chipguy joined #thegeekgroup
21:33 eadthem is it worth it to get windows xp 64bit
21:34 DeKemp yes
21:34 BatSteve as opposed to what?
21:34 eadthem or would it be better to just bite the bullet and get win 7
21:34 BatSteve Depends on what you're going to do with it.
21:34 astro73 joined #thegeekgroup
21:34 eadthem gameing and programming
21:34 DeKemp if you want 4 gigs of ram or more
21:34 eadthem in linux i will have 12GB of ram for ram disk
21:34 eadthem and 4 for ram
21:35 eadthem id like the same in windows as it shuld have several magintudes of speed increase for compileing
21:35 astro73|roam joined #thegeekgroup
21:35 wannabe|tgg astro!
21:35 wannabe|tgg you back in town?
21:38 eadthem cpu is a phenom II 1045  planning a RAID 1 with 2  1TB WD blue's
21:40 Monkeh eadthem: 4 may well be insufficient.
21:40 wannabe|tgg hi monkeh!
21:40 Monkeh Hey
21:40 wannabe|tgg when are you coming to visit?
21:40 eadthem thats the nice thing about a ramdisk  i can always set it to 10GB and then i have 6 for ram
21:41 Monkeh wannabe|tgg: :/
21:41 eadthem atm im flirting with limits with 3GB
21:41 eadthem err 2GB
21:41 eadthem im using 2.33 atm
21:42 eadthem think ile keep xp32 for now   when i can justify the cost ile get 7   if i even need windows by then.  im fully intent on running linux more than windows on the new system
21:42 tonsofpcs eadthem: you might be able to find Vista for cheap.  It can address more RAM
21:43 Katemonster back!
21:43 eadthem theres a good reason why i can find it for cheep
21:43 Katemonster is Electricguy still here?
21:43 eadthem afk for couple hours
21:43 Electricguy yeppers
21:43 Katemonster good news: i found one.
21:43 Katemonster at least i think i did
21:43 Electricguy YAYY! :D
21:44 Katemonster F20.0B2
21:44 Katemonster bad news: it's SMT  T_T
21:44 Chipguy thats not a chip
21:44 Electricguy yeah that should be 20MHz
21:44 Electricguy awe crap!
21:44 Katemonster yeeeah.
21:44 Chipguy ahh crystal ?
21:44 Electricguy Chipguy, no, a xtal
21:44 Katemonster yes
21:44 Chipguy yay
21:45 Chipguy Electricguy: just solder some wires to the smd crystal hehe
21:45 Chipguy i do that all the time
21:45 Katemonster i still think i can use it; the solder points aren't directly under the can
21:45 Electricguy solder the crystal to a tiny bit of protoboard or other copper board so you get a pair of terminals..
21:45 Chipguy looks crude but it works
21:45 Electricguy and then solder a pair of like resistor legs or something to it
21:45 Katemonster yeah
21:46 Katemonster anyway
21:46 Katemonster i also opened the alphastation and it's cleaner inside than i thought it would be.  it'll probably still boot.
21:47 * Katemonster goes to get the solder sucker
21:47 Electricguy awesome :)
21:50 Experimentonomen aight im heading to bed, nite peepz
21:50 Electricguy night
21:56 Electricguy bedtime. night all!
21:56 Katemonster bye Electricguy, thanks for your help
21:56 wannabe|tgg night eg!
21:57 Electricguy kate, you're very welcome. shout out if you need more help sometime!
21:57 Electricguy night wannabe :)
21:57 Electricguy and all others =)
22:02 wannabe|tgg .c 1,50 euro to usd
22:02 BotSteve 1,8777 U.S. dollars
22:13 Monkeh wannabe|tgg: Has anyone taught Steve to use a vacuum properly yet? :D
22:13 wannabe|tgg ?
22:13 electricguy_ joined #thegeekgroup
22:15 Monkeh wannabe|tgg: Haven't you seen the latest blog?
22:15 wannabe|tgg nope
22:15 Monkeh You should.
22:15 wannabe|tgg ok
22:16 Monkeh Specifically at 30:30 in..
22:16 wannabe|tgg thats the end....
22:16 Monkeh Pretty much, yes.
22:16 Monkeh But that's the Steve moment
22:17 wannabe|tgg ok
22:17 wannabe|tgg r2d2 first
22:18 Katemonster feh.  the needle and lighter method isn't working.
22:19 Monkeh Katemonster: :{
22:19 Monkeh Someone send Katemonster a soldering iron
22:19 Katemonster pleeeease
22:19 Katemonster eh.  mine will be back on wednesday.
22:20 Katemonster still annoyed.
22:20 Katemonster at least i found a crystal
22:26 wannabe|tgg yay crystals!
22:26 Katemonster maybe my oxy-mapp torch will work.
22:26 Katemonster :O
22:26 DeKemp why crystals when you can use cesium :P
22:26 Katemonster .....because?
22:29 Hackbat joined #thegeekgroup
22:30 Hackbat http://io9.com/5913643/how-the-zombie-apocalypse-starts-naked-man-found-eating-victims-face
22:30 BotSteve Title: How the zombie apocalypse starts: Naked attacker found eating man's face
22:30 Hackbat just throwing this out there
22:30 DeKemp http://www.youtube.com/watch?v=Gz3Cc7wlfkI  just some music
22:30 BotSteve Title: Apocalypse Now..Ride Of The Valkyries - YouTube
22:40 tehdark45 joined #thegeekgroup
22:40 KB3NZQ joined #thegeekgroup
22:46 Chipguy nite all
23:02 Carvagon so im workin on a song with clips from the captains blog lol let me know if u remember any funny sound bites so i can download em
23:03 DeKemp you wouldn't donwnload a car
23:04 DeKemp ''i had onionrings once, they where good''   that part of gibroni  epic!
23:05 BatSteve You wouldn't remilitarize the Rhineland!
23:05 BatSteve http://www.youtube.com/watch?v=wdSFe0UgB3E
23:05 BotSteve Title: Historical Piracy Warning Parody - YouTube
23:06 Carvagon lol ive already got liz sayin "thats why mother drinks", chris callin gibroni  "a sick bastard"
23:07 BitViper hey Carvagon : was it you that was looking for some ideas for 3d modeling practice ?
23:08 wannabe|tgg oh noes its BitViper!
23:08 Carvagon yeah but i dont have the software right now.  but i will when i get back to work.  got an idea?
23:08 BitViper what ? where ? *looks around panicked*
23:08 wannabe|tgg IN YOUR PANTS!
23:08 BitViper EEEEEEEEEKKKKKKKKKKK *rips off his pants*
23:08 wannabe|tgg o.O
23:09 wannabe|tgg get thee to NSFW good sir!
23:09 BitViper LOL
23:09 BitViper Carvagon : idea yes, based on something someone posted in fb yesterday. may i pm you ?
23:10 Carvagon absolutely
23:10 Carvagon im headed out in a couple minytes but we can go over it real quick
23:10 wannabe|tgg ok.  going to meijer now....bye all
23:12 DeKemp bye
23:16 wannabe|tgg see ya
23:24 wannabe1987 joined #thegeekgroup
23:25 wannabe1987 yay i have 2 gig ram in my netbook now!
23:32 exor674 go you \o
23:48 rawtaz joined #thegeekgroup

| Channels | #thegeekgroup index | Today | | Search | Google Search | Plain-Text | summary